Dataset for CDS herpesviridae of organism Coturnix japonica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q90343_vNR13-01 vNR13 gene OS=[Eukaryota] Coturnix japonica GN=vNR13 (length=534 residues).
atgccgggctctctgaaggaggagacggcgctgctgctggaggattacttccagcaccgggccggcggggccgcgctgcc
tcccagcgccacggcggccgagctgcggcgggcggcggccgagctggagcgacgggagcggcccttcttccgatcctgcg
ctccgctggcgcgggccgagccgcgggaggcggcggcgctgctgcggaaggtggcggcgcagctggagaccgacggcggc
ctgaactggggccggctgctggcgctcgtggtgttcgccggcacgttggcggcagcgctggccgagagcgcctgcgagga
agggccgagccgcctggccgccgcgctgaccgcgtacctggccgaggagcagggagagtggatggaggagcacggcggat
gggatggcttctgtcgcttcttcggcagacatggctcccaaccagctgaccagaacagtaccttaagcaatgctatcatg
gcagcagcagggtttggaatagcaggattagcttttctcttggtggtgcggtag
© 1998-2018