Dataset for CDS Unclassified of organism Callitrichine gammaherpesvirus 3

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q993L0_uncBALF1-01 Putative BALF1 gene OS=[Viruses] Callitrichine gammaherpesvirus 3 (length=522 residues).
atgaccgacgacgtgtttcaggacaatgcacctaaccttggggccgaggatgaaatggaccggggtgtcctgctacttac
tagggtcatgatagcggcatacctcgatgatccgggtaaaggcttgggcacggaggagcgtctctttctacgtctaatca
aacgcctaatgaagaaggaggaaaaaagattcgctgatatagtgaacagtggttcagcgcctaccacactccacggacac
atcaaacgcctgatgacatttaccagggcaatctacgaggatcacatggataattggtttcgtgtcagagcactcacgag
tttagccgttgcctacgcacgaagaaacatacctggggattcagagaatgccggacttttgttagtgggctttgcagaat
tcctatgtctatatcggagggcatggctttctcgactcgggggcatacgtgtgggattgagacgtgcttttcctctgacc
tggatgcgcatgcgagtcggagagagttgttacaaacaataa
© 1998-2018