Dataset for CDS herpesviridae of organism Bovine herpesvirus 4

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|Q1XBS6_VBCL2-01 V-BCL-2 gene OS=[Viruses] Bovine herpesvirus 4 GN=V-BCL-2 (length=681 residues).
atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggtgtgttctggggaggtatatattccaagtgt
attaaagtttcaatatcactctgacactgaacacgagccttactccaatctgtgtgaaaacttgataaccatggccgagc
aggacatggatgaggtggtctccacaatcaggaggctcttggtggaatgtggtatgggattggaagaatatttagaccat
cccgtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatctttagcaattttttaacaaa
tattaattctgtggaggatttggagaccctgggccacgccatcactacgttaaatgactatccctccccaaacatgggca
gagttgtatgtggcatagcattctctgtctatgttgtccagactgtgtgtaagagaaaaccactattggtcaggtgctgc
ctagacatctttacgagagccactgtccaggctttgaatgttaattggtttttgcaggaaggtgggtggccggctcttgc
atcattctgcaaggtggttaatagcccaagcccccgctccagatggttatttcccatgcttgccatctccggcctggtac
tgactgtgggtgtggcgagaaacatggtacattttacctaa
>gnl|bcl2dbcds|Q1XBS7_VBCL2-01 V-BCL-2 gene OS=[Viruses] Bovine herpesvirus 4 GN=V-BCL-2 (length=681 residues).
atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggtgtgttctggggaggtatatattccaagtgt
attaaagtttcaatatcactctgacactgaacacgagccttactccaatctgtgtgaaaacttgataaccatggccgagc
aggacatggatgaggtggtctccacaatcaggaggctcttggtggaatgtggtatgggattggaagaatatttagaacac
cctgtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatctttagcaattttttaacaaa
tattaattctgtggaggatttggagaccctgggccacgccatcactacgttaaatgactatccctccccaaacatgggca
gagttgtatgtggcatagcattctctgtctatgttgtccagactgtgtgtaagagaaaaccactattggtcaggtgctgc
ctagacatctttacgagagccactgtccaggctttgaatgttaattggtttttgcaggaaggtgggtggccggctcttgc
atcattctgcaaggtggttaatagcccaagcccccgctccagatggttatttcccatgcttgccatctccggcctggtac
tgactgtgggtgtggcgagaaacatggtacattttacctaa
>gnl|bcl2dbcds|Q1XBS8_VBCL2-01 V-BCL-2 gene OS=[Viruses] Bovine herpesvirus 4 GN=V-BCL-2 (length=681 residues).
atgtctctgttttttattgtttggtactgggtgaattatataacaaaggtgtgttctggggaggtatatattccaagtgt
attaaagtttcaatatcactctgacactgaacacgagccttactctaatctgtgtgaaaacttgataaccatggccgagc
aggacatggatgaggtggtctccacaatcaggaggctcttggtggaatgtggtatgggattggaagaatatttagaccat
cccgtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatctttagcaattttttaacaaa
tattaattctgtggaggatttggagaccctgggccacgccatcactacgttaaatgactacccctccccaaacatgggca
gagttgtatgtggcatagcattctctgtctatgttgtccagactgtgtgtaagagaaaaccactattggtcaggtgctgc
ctagacatctttacgagagccactgtccaggctttgaatgttaattggtttttgcaggaaggtgggtggccggctcttgc
atcattctgcaaggtggttaatagcccaagcccccgctccagatggttatttcccatgcttgccatctccggcctggtac
tgactgtgggtgtggcgagaaacatggtacattttacctaa
>gnl|bcl2dbcds|Q99D15_VBCL2-01 V-BCL-2 gene OS=[Viruses] Bovine herpesvirus 4 GN=V-BCL-2 (length=681 residues).
atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggtgtgttttggggaggtatatattccaagtgt
attaaagtttcaatatcactctgacactgaacacgagccttactccaatctgtgtaaaaacttgataaccatggccgagc
aggacatggatgaggtggtctccacaatcaggaggctcttggtggaatgtggtatgggattggaagaatatttagaacac
cctgtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatctttagcaattttttaacaaa
tattaattctgtggaagatttggaaaccctgggccacgccatcactacgttaaatgactatccctccccaaacatgggca
gagttgtatgtggcatagcattttctgtctatgttgtccagactgtctgtaagaggaaaccactattggtcaggtgctgc
ttagacatctttacgagagccactgtccaggctttgaatgttaattggtttttacaggaaggtgggtggccggcccttgc
atcattctgcaaggtggttaatagcccaagcccccgctccagatggttatttcccatgtttgccatctccggcctggtac
tgactgtgggtgtggctagaaatatggtacattttacctaa
>gnl|bcl2dbcds|Q9WH78_VBCL2-01 V-BCL-2 gene OS=[Viruses] Bovine herpesvirus 4 GN=V-BCL-2 (length=681 residues).
atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggtgtgttctggggaggtatatattccaagtgt
attaaagtttcaatatcactctgacactgaacacgagccttactccaatctgtgtaaaaacttgataaccatggccgagc
aggacatggatgaggtggtctccacaatcaggaggctcttggtggaatgtggtatgggattggaagaatatttagaacac
cctgtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatctttagcaattttttaacaaa
tattaattctgtggaagatttggaaaccctgggccatgccatcactacgttaaatgactatccctccccaaacatgggca
gagttgtatgtggcatagcattttctgtctatgttgtccagactgtctgtaagagaaaaccactattggtcaggtgctgc
ttagacatctttacgagagccactgtccaggctttgaatgttaattggtttttacaggaaggtgggtggccggcccttgc
atcattctgcaaggtggttaatagcccaagcccccgctccagatggttatttcccatgtttgccatctccggcctggtac
tgactgtgggtgttgctagaaatatggtacattttacctaa
© 1998-2018