Dataset for CDS Unclassified of organism Bovine gammaherpesvirus 6

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A060CXQ6_uncA9-01 Putative A9 gene OS=[Viruses] Bovine gammaherpesvirus 6 (length=522 residues).
atgcagtttaaagacattgaagctggccgggttgaagaagaccgtactgaagaaacagatgaagcgggctgctccgatat
ttttatccaccagctcaagctggccttaataaaaggcggcataaagtacatatacgccaactggattattgatacagcta
aagagaagagcgcccaattaattgaaaagtttgacagcctgagcaaggatgtagagtttagcactccggatgatctgaaa
ctcgtcctcaactctatgtttgaagacggagtcaaccttggaagggttactgtgtttttcgcttatgtgatatacctgca
cttaaagttggaggactgcagcttcccagatgcccactacactgtaattaaggaaaccatggacacctacattattccct
ggctgcaaacaaacatttccagcattaaggaaatgtcctcgtctattgctaacgtatttgcaaccctggttgctcctatt
gctttgggaattgcatctatgtttctattccaaaagggctaa
© 1998-2018