Dataset for CDS Unclassified of organism Astyanax mexicanus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5LAB6_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Astyanax mexicanus (length=531 residues).
atgtcctgttggttaaggaaagagactctggcgctggcggaggactacatccgcttctgcaccggggaccaacggacgcc
ccccagcgagtcggccgaggccatgcgccgcctggccaaagagatggagcggcaacaccattctaaattccactcgctgt
cccagagcttcctgacggcctgcggcgcagaccccagcgcgtgcctccggagcgtcatggccgtgctggtggaggacggg
aagctgaactggggcagagttgtgtcgctgtttacattcacaggcgttctggccactgaactattctctagaggagacgg
gccggagtgctgcagcaggttagcagagactatagctgactacctgggagcagagaacaaagaatggctgctggaaaatg
aaggctgggagggattctgtaagttcgtccgcagagcgggacatctaggtcaagattcctccatgaaaacagcactgttt
gctgcggcaggagtcgggatagctggactgacctttctcctcgtgcgctga
© 1998-2018