Dataset for CDS Unclassified of organism Alcelaphine gammaherpesvirus 2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A068AAN3_uncA9-01 Putative A9 gene OS=[Viruses] Alcelaphine gammaherpesvirus 2 (length=498 residues).
atgggggaacctgagtttcaagacaatgtgctttattatttatttctcgatgaacttaattttgtgttaataaggaatgg
attttcctgcagccatgcgaagttgatcatggatgaaactcgaaaaagggtcacggactacagtgaacaatttgaggtga
ttagcaaggccgtagaacccccagaaccagagtcgctaggcaggattgcagcgtctctcctcacccccaatcccaactgg
ggtcgattggtggctttttttgcctacctggcttatttgcagaggaattcttcacacaaagtttttacaaaaaaccacat
aaagcaattaaaaaaaatagttaagaaacatgttgtaccttggaattcagatttaaaaggcagcaaagcgaaactacctg
cacctcgccaacctttaaagtctacgctcctgttaaccgcagcagcttcttgcctcactttttttctcatctatttccga
tccatcagagcaaagtga
© 1998-2018