Dataset for CDS herpesviridae of organism Alcelaphine gammaherpesvirus 1

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1L2JVL1_A9-01 A9 gene OS=[Viruses] Alcelaphine gammaherpesvirus 1 GN=A9 (length=507 residues).
atgaaaatgttgggagaacccgagtttaaggagaacatcctctattattcattcctaaatgaactgtttttaatattaat
aagaaatggattttcctgcagccacgcaaagttaatacttgatgaaacccggaagaggggcctcgagtgcagtgggcagt
ttgaagtcatcagcaactctgtagaagcccccgagcctgagtcactggagaggattgcaaaaacactcttcacaccccgt
ccacactgggggaggctggtggcatttctagcatacttggcttatttgcagaagaattcaacagagaaactcttctggaa
tgaccacttgaaaaaactcaaacaaatagtcaagtgccacatcgtgccctggaccctgggaccgagagatccaaaaccga
aacagcgtccatttgataaattacctagcgccttttatttcttaaccgcagcagcttcttgtttgacgctactgcttcta
tacttccgaaccactcaaacgaaatga
© 1998-2018