Dataset for CDS Unclassified of organism all

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0C5AZX0_uncLMW5HL-01 Putative LMW5-HL gene OS=[Viruses] African swine fever virus (length=540 residues).
atggagggagaagagctcatatatcataatatcattaatgaaatactcgtgggatacgttaaatattacatgaatgatat
ttcagagcatgaacttagcccgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttgaacaagcagg
ttacaattaccttttctcttacgagtgcccaagaaattaaaacccagtttactgaggttgtgactgagttgtttaaggat
cttatcaactggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtactgcaaagatgccaataacca
tctggagtccacggtgatcactacggcatacaacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
aagaggagtttttggctttctctctacacagtgacatttattccgtgatttttaatattaaatatttcttatctaaattt
tgtaatcacatgtttttaaaatcctgtgtacatttattaagaaactgcaatttgatctag
© 1998-2018