Dataset for CDS Unclassified of organism all

[Download (right click)]

33 sequence(s)

>gnl|bcl2dbcds|G1FQL6_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat adenovirus 2 (length=543 residues).
atggatctcttgcgcgcttgcagtacttactctgcttttaaatatatgatgaaggggagcacttataactctgggtgggt
taggagatggtgttttccggggctttcagaggtggtcgggactttggctgagactcactcttatagattctggaacatga
tgcccaggcggcatttgtattgggatttagttaggcgtgggtattgtacttctttttttgaaataatgtttcgcaaggca
gatttgagcaaccgggggcgcgtattagcctacttggcctttgtgtctttcttgctgagaaactggcctcaggactctgt
tgttcctgaagcggatagacttgatttaatttgtattccagcatggaccagaatgcagtcttggcagcaaacggtgaccc
taatgcaggaaatagaggagatccagcaaggcaccggggcagaggaatgtacagacgccgagcaggccttcgtggaggag
gaggaggagcagggcggagggagcagtcccgacccccttacggagggctcgatgcagccctag
>gnl|bcl2dbcds|D3X7A9_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat adenovirus TJM (length=549 residues).
atggatccactcgctctgtgtgccgactatagcacatttcgctttattattaggggcagcttgtgtggctctgggtgggt
gcgacgattctgttttccagctttggcaaatgtgttggctgaggtagcagaggaatatgaggaggggtactggagagctt
tcccccctgaggactacaactgggacttgcttagacggggttacacttttgccgcttttgtagatttgtttagcacagtg
gatttgagcaacggaggcagggtgctttcctttctagggtttttatcttttatcttacggtattggccttctgattctgt
agttcctgcggcggatagacttgatttcatttgtatcccagcatggacgaagatgcagctatggagccagtccttgaggt
tcatggaagagctggagagcgcgatggccgcccggcgggaaggcatggggtccgatcccgctcccgcccccgccgaagaa
cctactcagccagtcaggctcagggccatcacgcggagcacgcagacggacctagaccaccaggattag
>gnl|bcl2dbcds|A0A161DIM0_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV10 (length=954 residues).
atggactacctcaagtttttatccaactatgctgtgctgaagaggattgttcgggactctagtgagaggactggaccttg
gaggcgatatttcttttgtggacctttagttaactttgtgcataagatcaagctagaccacaaagaagaatttgagcagt
gcttggatgctgagggaatatttttggatcgtttgcgcagtggtgatctttctgtatacaatactcaagttgtattacat
ctgcatttggaaaatcctgggcgcgtggctgctagcattgcctttgtagcttggcttcttgatcagtgggatttacaaaa
tcaattttctcctgatttctctctggacgcgctttgtattccactatggaaactaatcagggcggaggtatgcaaccggg
atctgagtgcagcggctcgggtgtttcaggaggagctggagcgggagggcttgatagatcccccggagacactagcggag
gagagtcccgagagggcggacaacgaggagggggacttgcatctagcggagccagctgtagttcaggagacggggagcga
ggaggaggacgaggagatgcctcccctggaggagagcgaggaggagagcgagagcttgggggaggaggagttggaggaag
tggagacggagggggacagcgagctggaagtagtttttgcctccgagaacgatgttctgagtccgaccccggacctgttg
aggcagggtgcagcttctggtctgagcagcagcagcgaggaggtgtgtttcagcccattgagcggggtggctccactggc
ctcttcggacagctcttgttcagagccagaagaagaagagagggtcgtgcctccgaacggggggcgcgccatccgggtca
gcgtgatcgttcacgctcccgctcaagggaccggaggggctcagggacagagcttgtcaggtgggaggatgtaa
>gnl|bcl2dbcds|A0A163HKI5_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV11 (length=954 residues).
atggactacctcaagtttttatccaactatgctgtgctgaagaggattgttcgggactctagtgagaggactggaccttg
gaggcgatatttcttttgtggacctttagttaactttgtgcataagatcaagctagaccacaaagaagaatttgagcagt
gcttggatgctgagggaatatttttggatcgtttgcgcagtggtgatctttctgtatacaatactcaagttgtattacat
ctgcatttggaaaatcctgggcgcgtggctgctagcattgcctttgtagcttggcttcttgatcagtgggatttacaaaa
tcaattttctcctgatttctctctggacgcgctttgtattccactatggaaactaatcagggcggaggtatgcaaccggg
atctgagtgcagcggctcgggtgtttcaggaggagctggagcgggagggcttgatagatcccccggagacactagcggag
gagagtcccgagagggcggacaacgaggagggggacttacatctagcggagccagctgtagttcaggagacggggagcga
ggaggaggacgaggagatgcctcccctggaggagagcgaggaggagagcgagagcttgggggaggaggagttggaggaag
tggagacggagggggacagcgagttggaagtagtttttgcctccgagaacgaggtgctgagtccgaccccggatctgttg
aggcagggtgcagcttctggtctgagcagcagcagcgaggaggtgtgtttcagcccattgagcggggtggctccactggc
ctcttcggacagctcttgttcagagccagaaggagaagagagggtcgcgcctccgagcggggggcgcgccatccgggtca
gcgtgatcgttcacgctcccgctcaagggaccggaggggctcagggacagagcttgtcaggtgggaggatgtaa
>gnl|bcl2dbcds|A0A1B0UI04_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV12 (length=417 residues).
atgaagaagacctataaggacgttcttcgttcttacaatactgtccgagacattttagccggggcctcggataaaacttg
gtttttttatcgcaagcttttttgccacagatgggtctattcagtgcatcgaattaaaatagattataagaaagattttt
ttaatattttggagctgtggcctcagattttgcaatttttagagattggaaatacttattattttgagaaaattgtagtg
ccggagttaatttttgatacttttgaaagaacaattgtttctttagcttttgtggcttttttaattgatcggtggaagga
gcaaggaattttttcttgggattatattatcgaaacagccgctttgcaagtatggcaggccttcatgaggatgttgtgga
gagagaatctgttatga
>gnl|bcl2dbcds|A0A1B0UHW6_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV13 (length=420 residues).
atggaagcaaactacattcagtatttgaagtcctactctgattttcgggacttactgaatggagcttcggcccggactgg
ttttttatatcgttggcttttttgtgataaactaacttattgggtttatcgagtgaagattgaaaatcgagttatttttg
aagaaatagtaaaagattttcctgagactttttttgaatctttagaagctggttatacttgtgattttgaagactcaatt
gttcctcaattggaatttttgtctttgggacatactttatcttctttggcttttgtggtttttcttattgattattggaa
agaaaattctgttttttcctgggattttattattgaaagttttggcttaataacatggcgagcaataataatggccttca
ccagggagaagctgttgtaa
>gnl|bcl2dbcds|A0A1X9RIQ7_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV17 (length=507 residues).
atggagagggctgcagacatccctttttcttttcagggattaaagcatattttgactttgacttataaagcttctaagtc
ttcttggttttggagaaaattttgtactccttctttaattcttgctattcttgaggctaaggaatcttatgctgaggact
ttgattcttttttaactactgatttttgcttacaaagttttttagatacattagattggcagtctttagaaaaatcttta
attcccaatttggatttttcttcttcggggagagctattgctagtttggcttttttatctagtattatagaccgcttgga
attttctactatttttacatcttcatatttaattgaaaattttgcttttgctgtgtggagatgggcgataacattgacga
agggatcgaagacatcggagcagttgaaaatgtcgaaaatgaagacccccgagctaacggagaagcaggaggaggcgctg
acggagctaatgaagagttgggattaa
>gnl|bcl2dbcds|A0A1X9RIT9_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV18 (length=507 residues).
atggagagggctatagacatccctttttcatttcagggattaagacacattttgactttgtcttataaggcttctaagtc
ttcttggttttggagaaaattttgcactccttctttaattcttgctatagttgatgcaaaggaatcttatgcggaagatt
ttaattcttttttaactacagatttttgtttgcaaagttttttggacactttagattggccttctttagaaaaatcttta
attccaaacttggatttttcttctccaggaagagctattgcaagtttagcttttttatctagcattattgaccgtcttga
atttgctacagtttttaccccttcctatttaatagaaaactttagttttgctgtgtggagatgggcgataaccttgacga
aggaatcgaggacatcggagcagtcgaagatgttgaaaatgaagaccccagacctaacggagaagcaggaggaggcgctg
atggagctaatcaagagttgggactaa
>gnl|bcl2dbcds|A0A163HHM5_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV9 (length=954 residues).
atggactacctcaagttcttaaccaactatgctgtgctgaagaggattattcgggactctagtgagaggactggaccttg
gaggcgctacttcttttgcgggcctttggctaattttattcacaagatcaaggaagaaaataaggagctttttgctcagt
gcttggattcagagggacaattcttggagcttttgcgcagcggggatcttgctctgtacaacactaaggttgttcctgct
ttacaatttgagaatccggggcgggtggctagtagcttggcttttgtggtgtggttgcttgatcagtgggatcttcagaa
tcaattttctcctgagttttctttggaagctctctgtattccagtatggaagataatcaaacaggaggtagctcagaggg
aactggggacagcggctcgggttttccaacaggagctggagcgggagggtctgatagatcccccgggatccatggtgggg
gagaccccggagagggaggacacggaggaaggggagttgcatctagcggagccagcagtgattcaggagacggagagcga
gggggaagaggaggagatgcctcccctggaggagagcgagagcgaggaggagagcatgggagaggaggaattggaggaag
tggagacagaggaggacagcgagttggaagtagtttttgctgccgagaacgaggtgctgagtccgaccccggacctgttg
aggcaggctgcagtttctggcctgagcagcagcagcgaggagcagtgtttcagcccattgagcggggtggctccactggc
ctcttcggacagctcttgttcagagccagaagaagaagagagggtcgtgcctccgagcggggggcgcgccatccgagtca
gcgtgatcgttcacgctcccgctcaagggaccggaggggctcagggacagagctcgtcaggtgggaggatgtaa
>gnl|bcl2dbcds|A0A1J0FAP3_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=546 residues).
atggatcttttctctatgtgcgccgattatagctcttttagatatattttaaggggtagtctctgtggcagtagttgggt
tagaaagtggtgttttcctgctttagcagatgctattactggcattgcagatgattacgaggatggatactggagagctt
ttccgccagatgatattaactggaacctcctgagaagaggttacacttttgcagcttttacagatttgtttagcagtgtg
gacctaggcaatgctgggaggtttatgtcttttctggggtttttaaacttcattttgcgtaactggccttctgattctgt
agtgctttctgcagatagacttgacttaatctgtgttccagcatggacgaagatcatgctatggagccaaactatgaggc
agatggaagagctgcagctgttggaaatggcggccgcgcaggcagcggcggcggccagaggggctcgggcagaagagacc
agcgagaccaccccgctgctgcagtcaaccagcacccaaacggagcagctggaaacggacttgtag
>gnl|bcl2dbcds|A0A0M4LS43_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bottlenose dolphin adenovirus 1 (length=660 residues).
atggacttgaaatttctcgaattgctcgggaaaagagactaccttcgtcggcttttagaaaacgcctcacttcgaacatc
aagcttttacaggtttattttttgtgattctttaactaaattagtttatactgcttgggaacaatatcatcaaaattttg
atgaaattcttccccaggggtcttctttttgggttgttttaaattctggtcgaattggtgcattgcatggtgctctccaa
agtgtagatttttctagcaacggtaggggtattgctagtttggcatttttagttaacattttaaatcatttggacgcttc
tggtgcttatagcaaaggttttactagtgaaatcttatcacttttagtatggccgaaaataaggtttgtgctgaattaca
agaaaatagcagcgctagaagcagaagtgtacccatctatgtcaacttcccgtttgcctccaataacgcgaatggttcca
atgaacagaatcagggaccaggagcaagaggcgaatgtggaacaaccagaagacgaagttccagcacagaatctattcaa
tcctcgaactcctcctctgagcagcagcagcagccagagcagtcagaacagcctagacagcgagtcggaatcagacgagg
ggtggttggcaatggattag
>gnl|bcl2dbcds|A0A1X7MN46_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bottlenose dolphin adenovirus 1 (length=552 residues).
atggacttgaaatttttgcttgctttagataataagaagtatcttgaaaagcttttagttttagcttctaaaagaacttc
tttcttatatagaacgttttttgctgatgatttaattaagctagttcatagcgctagtaatgattataaaagtaactttg
aagatgttttacccgctggttgttctttttggattttgttaggttctggaaaaattggtactcttcaaggcctgcttcat
agcgtggatttttctagtaacggaagaggtgttgctagtttagctttttttgtccatattttaaattgtttggacgaatt
tctttttttttctaaaacttttaatttggaggttttagtgaatacattatggccaaccatccattgcgccttgaaccagc
agcgggtgaacgtgttgcaaggggcaatgaaccagctgacggagacgccggtcccctcgatcgagtcattaatctcccca
gagagctcgggctcggagaacgagtcagatccagtagcggaattagaagagggctccttggagacggaatag
>gnl|bcl2dbcds|Q9EEG2_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bovine adenovirus 2 (length=480 residues).
atggacttgtcacttcagctttgcgagcagctaagcagcttacctcagttgcggagggtgatctactacgcaacaaatcg
ggcaagttggtggtctaggactttctttgggggcagactcgctaacttagtctatacaattaaggttgaagaagcagaat
ctctccaggaattgtttaatgaggatgaaggtttttggcagatgtttggcagtggcaggacactaggctatgaatcaaaa
attgtaccttggctagacttttcaactccagggagagcgactgctagtttatcattgcttgcttacattgtagactgttt
agataaacagtctgagctttctagtgactttattttagacgctgtgtgtggaccagtatgctacaagctcaagatgctgc
tgtccctgcagaagcttcaggggcatctgtcagggtccagcgtgggttccacttgccattcgcgagaggaaacggattag
>gnl|bcl2dbcds|G9HQG8_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bovine adenovirus B serotype 3 (length=474 residues).
atggatcacttaagctttcttctggatttgaagctgcttcgctctatcgtagcgggggcttcaaatcgcactggagtgtg
gaagaggcggctgtggctgggacgcctgactcaactggtccatgatacctgcgtagagaacgagagcatatttctcaatt
ctctaccagggaatgaagcttttttaaggttgcttcggagcggctattttgaagtgtttgacgtgtttgtggtgcctgag
ctgcatctggacactccgggccgagtggtcgccgctcttgctctgctggtgttcatcctcaacgatttagacgctaattc
tgcttcttcaggctttgatccaggttttctcgtggaccgactttgcgtgccgctatggctgaaggccagggcgttcaaga
tcacccagagctccaggagcacttcgcagccttcctcgtcgcccgacaagacgacccagactaccagccagtag
>gnl|bcl2dbcds|Q64843_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bovine adenovirus B serotype 3 (length=474 residues).
atggatcacttaagcgttcttttggatttgaagctgcttcgctctatcgtagcgggggcttcaaatcgcactggagtgtg
gaagaggcggctgtggctgggacgcctgactcaactggtccatgatacctgcgtagagaacgagagcatatttctcaatt
ctctgccagggaatgaagcttttttaaggttgcttcggagcggctattttgaagtgtttgacgtgtttgtggtgcctgag
ctgcatctggacactccgggtcgagtggtcgccgctcttgctctgctggtgttcatcctcaacgatttagacgctaattc
tgcttcttcaggctttgattcaggttttctcgtggaccgtctctgcgtgccgctatggctgaaggccagggcgttcaaga
tcacccagagctccaggagcacttcgcagccttcctcgtcgcccgacaagacgacccagactaccagccagtag
>gnl|bcl2dbcds|A0A059XJ33_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] California sea lion adenovirus 1 (length=444 residues).
atggagcagctgaaggattattccttttttaaggaggttgttgagcatgccagtctaaggactgggaatttgtatagatt
ttttttttcttcttctttagctaaagttgtttttcaggtttatttagaaaaggttggggaatttgatcgtctggattcta
cagcttcagctttgcttgctttatcacaaggaaataattttttgtttgagaagcttattattcccgaacttcctttttat
tcttttggacatattttagcttctttggctttttgtagtttttgtgttaataaagcagatatatctgctactgttagttc
tggttttatattggatgctgtttgtagaccagcatggcagaagttcatgatgagccacaacatgatggagaaccagacgg
gatcatcggaattctccctagaagaagcgctgaccgacaattag
>gnl|bcl2dbcds|Q65942_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Canine adenovirus serotype 1 (length=510 residues).
atggaccctcttaagatctgtgaaaactatttgactttcaggtctataatcaaaggtagcactttttcgccaggcgtgtt
taggcggtggcgcttccatgctttggccgatgttgtcggtaacatagtggaacgggaggaaggcaggttttgggaaattg
ttcctgaaacccacactttgtgggcgctttttcgaggaggcttcaccgttgctccttttactgaaattcttacatcactg
cagcttgaaaacagaggcaggcagttggcttttttagcttttttgtcttttttgcttcgcaactggccttcagactcagt
agtgtctgaggacgctagacttgacttggtctgtgcgccggcatggagcaggattcagatctggagtcaggccgcgcgac
taatcaacgacctcccagagtccgtgttcgaggggcaggggtccgtggtagaggaagagtgcggagaagagcacttagcg
agggacagcgacgatccccttttcgactag
>gnl|bcl2dbcds|Q96678_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Canine adenovirus serotype 1 (length=510 residues).
atggaccctcttaagatctgtgaaaactatttgactttcaggtctataatcaaaggtagcactttttcgccaggcgtgtt
taggcggtggcgcttccatgctttggccgatgttgtcggtaacatagtggaacgggaggaaggcaggttttgggaaattg
ttcctgaaacccacactttgtgggcgctttttcgaggaggcttcaccgttgctccttttactgaaattcttacatcactg
cagcttgaaaacagaggcaggcagttggcttttttagcttttttgtcttttttgcttcgcaactggccttcagactcagt
agtgtctgaggacgctagacttgacttggtctgtgcgccggcatggagcaggattcagatctggagtcaggccgcgcgac
taatcaacgacctcccagagtccgtgttcgaggggcaggggtccgtggtagaggaagagtgcggagaagagcacttagcg
agggacagcgacgatccctttttcgactag
>gnl|bcl2dbcds|P14265_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Canine adenovirus serotype 2 (length=510 residues).
atggaccctcttaagatttgtgaaaactaccttacttttagagctataattaggggaagtactttgtcgcctggattttt
taggcggtggtgttttcctgccttggctgatgtggtgggcaatatagtggaacaggaggaaggcaggttttggcaaattt
tacctgaaaaccacgctttttggggtcttttgcgcaggggctttactgttgcttcttttactgaaattattacagcagct
cagctggaaaatagaggtagacagttggcctttttagcttttatatcatttttgctacgcaactggccttctgactctgt
agtgcctgaagctgacagacttgacctggtctgtgcgccggcatggagcagaatgcagatatggagccagaccgccaggt
taatcaacgacctccaagattccgtgctcgaggagcaggggtccgcggaagaggaagagtgcgaagaagcgcttttagca
ggggacagcgacgacccattattcgggtag
>gnl|bcl2dbcds|A0A1J0MUK8_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Canine mastadenovirus A (length=510 residues).
atggaccctcttaagatctgtgaaaactatttgactttcaggtctataatcaaaggtagcactttttcgccaggcgtgtt
taggcggtggcgcttccatgctttggccgatgttgttggtaacatagtggaacgggaggaaggcaggttttgggaaattg
ttcctgaaacccacactttgtgggcgctttttcgaggaggcttcaccgttgctccttttactgaaattcttacatcactg
cagcttgaaaacagaggcaggcagttggcttttttagcttttttgtcttttttgcttcgcaactggccttcagactcagt
agtgtctgaggacgctagacttgacttggtctgtgcgccggcatggagcaggattcagatctggagtcaggccgcgcgac
taatcaacgacctcccagagtccgtgttcgaggggcaggggtccgtggtagaggaagagtgcggagaagagcacttagcg
agggacagcgacgatccctttttcgactag
>gnl|bcl2dbcds|A0A1Y0B6F3_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Cervid adenovirus 1 (length=474 residues).
atggatcatttagatattctgatagatttgaggctattgcgctccgtgatagcgggggcctcaaatcgaactggcgcctg
gaaaagaagattgtggctggggcgcttaactcaactggttcataacatttgctcggagaaccaggagagctttttaaact
ctctacctgggaatgctaattttctgaggctgctacgaacgggctattttgaagtttacgacgtctttgtggttcctgag
ctgcatttggattctcctggacgggtggttgctgctttggctcttctggtcttcattctcaacgatttggatgcgcattc
tgctgcttcaggcttcgattcaggtttcctaatcgatcgcctctgtgtgccgttatggctcaaggcccgggcatacaaga
tcacccagagctccaggaccaatttgcagccttcctcatcgccagacaagacgaccccgacttccagccaatag
>gnl|bcl2dbcds|A0A1B0XB89_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Equine adenovirus A serotype 1 (length=786 residues).
atgcaacagaggacgcggaaactgagacagcggatgaggaggccggtcacgatgaccaggcgtggtgctccgggggcgtg
gcggaacaagaggagcccttggacctgtctgtcagacactcccgttaaatcagaaaataaaaaacagatttgtggtcacg
caacgggagtggtcgtcttacttataagcgcgtgtttggtttggcttcttcacttgcttttcaggcagggtttgggggag
gtaggcatggaggttttgaattattgcagaaactactatgagtttaggaggatgataaaggggactacttactctctggg
gtgggttaggaggtggcttttctctcctctgtcagatgtggtgtgcatggtggctgagaaaaacgagctggcttactgga
gggcgctgcctccgagccacttttactgggatatgctgaagagggggcacgctttcttcgggaaagaagacctgtttgct
tgtgttgatctatctacggggggtcgtgtgcttgcttccctaggcttcctggcttttgtgttgcgccactggccccgcga
ctctgttgtcccttttgagcagaggttggatttgatttgcgccccagcatggacccgaatgcagatgtggatccaaatgg
aagagagccgggccctcgagcagcagcagccgcccgaggagaccatagaggaggaggaggaaacctccgacgcggaggaa
acggggtcgatggaggggctagaagacagcgacgaggaagacctcgaatccttggtggtccggtaa
>gnl|bcl2dbcds|G5CZ72_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Equine adenovirus A serotype 1 (length=540 residues).
atggaggttttgaattattgcagaaactactatgagtttaggaggatgataaaggggactacttactctctggggtgggt
taggaggtggcttttctctcctctgtcagatgtggtgtgcatggtggctgagaaaaacgagctggcttactggagggcgc
tgcctccgagccacttttactgggatatgctgaagagggggcacgctttcttcgggaaagaagacctgtttgcttgtgtt
gatctatctacggggggtcgtgtgcttgcttccctaggcttcctggcttttgtgttgcgccactggccccgcgactctgt
tgtcccttttgagcagaggttggatttgatttgcgccccagcatggacccgaatgcagatgtggatccaaatggaagaga
gccgggccctcgagcagcagcagccgcccgaggagaccatagaggaggaggaggaaacctccgacgcggaggaaacgggg
tcgatggaggggctagaagacagcgacgaggaagacctcgaatccttggtggtccggtaa
>gnl|bcl2dbcds|A0A0K1DBT8_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Equine adenovirus B serotype 2 (length=417 residues).
atggatctgatgaagcttttagatttcaaagagtttaaacgctgtgtctatttagcatctaataggtgtaggtggtggga
gaagattttctgtactcggttcattaaatttgtgcgtcagataaaaaaagagaattttctagagtttgctgaacttatcc
tctgtaacacagctttttcaagttgtctaaagtctggacaggtgtctctttttcataatactgtgttatgtgaacttgac
ttttccaaccctgggcgtgttgtcactaacctggcctttttgtcatatttgattgatatgtgggatcaggttgatgtatt
ttcccatgaatttattttggagtctgtctgctttccagcatggcagcgattcaaccagactcagccgaagggggtgttga
agagcacagaagtgtga
>gnl|bcl2dbcds|A0A219PC56_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 (length=240 residues).
ttggataaatggatccgccaaactcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatg
gaaggctcgcaggatgaggacaatcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccac
cgaccatgccagcggttctgcaggaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|E7CH29_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Murine adenovirus 2 (length=1002 residues).
atggatctgttaaagcatttgagcgaatataaggtgttgagagatttagtcttggagagttcttctttcaagccgtggtg
gtggagacgtagggggttatcgaatctggttcgagaaacgatagaaaagttcagaacggagtacgaagaagtgctcggtc
aggtcttttttactcgtttgaatcatcaagacttttttctttaccactacgtgattcgcgaagaattagatctgagtact
ccgggtcatcagatttccggcatctctttcgtggtgtatgtgctcgagcgttgggcgctgttggagcaacgtttcgggcg
tgattacttggtagactccctggtgtttcccctgtatcagcgggtgcgctcggagctgagatggcagagcagacaagttc
tcaagccggtgcgtcgcttcaggcggagccaggctcttccggcggagcagcggcagtcgatgccgtttccctttcagggg
gatcggccgacggagccccttcttcccagcttcaggctgagccgttcgagccctccgtctccgaaccgtccgcagagtcc
gttgccagccctggtggtgaatcagtcgagtcgggtccctccgccctcgaacgcgaccgcagcggctccggggtgccctc
cgccaccgacagtgatgataccgacatcgaaaagtctccggccgcggtcgtgccccagtggcgcgatttttacgtcttcg
agcatcgacccgaacccgagccagcggacgtccccgccccggccgccgccgaagctgtaccagcaccagtaccagaacct
gatgctgagcgagacgacctcggagatggcgagcctgacggtgtcgtccccgacgccgccgctgccgccgatgcccccca
cggagacgccggtcgagaaggcgaggaggggcagcagcgacagcctcagttccgagcgcgaggggtcatatcggaaagtc
ccgggtacgccggctcggtgccggagggcgttgcagctatag
>gnl|bcl2dbcds|P12535_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Murine adenovirus A serotype 1 (length=528 residues).
atgttacctgtgtatcctttcttggctcctgtctttgatacttttgagtcgactcgtgctttatttttggaggcgactct
gtctttacaggagccttggtggtttcgactgcttagtttttttagatcccctcgttacacggggctagcagatgtggtta
gagccattgcttgtgagcgcgaggctgattttaccgctattactccctcttctttaatcgaggatattgcagagggacgt
tttgtgatgcttgttgggcttatggagtatttgcgttttgatactgcgggccaaggcattgtttcatttgcttttttgtc
ttatcttattgatagggttacgaagcaaagccctcttgcgcattttactgttgtagaggttgtgtctttggtggtatgga
ggaccgtcaagctctcgaggaggcgggagaggagatgggtttcccagttgtcaacattagcggaggaggacgaggacgaa
gagggaactactctaacgacggaagcggagcaagagagctcagcttga
>gnl|bcl2dbcds|Q994F2_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Porcine adenovirus 5 (length=492 residues).
atggagcttgaactaagcttgaagctctgcaagaccctctgcgattttaagaacctgactcgggtcgtctattatgcttc
tgacagaccaggttggctctctcgctatttctttgggggcagactcgctcaattagtttataaggccaaggttgactacc
accagacactgactgaactgtttgaggatgatcagagcttttggtgtttgttagagagtgggagaacgctgggattcgag
gcaaaggtggtgccgtggttagatttttcatcaactggtagggttgtttctagtttgtcattattggcatacttggtaga
ccaccttgattgtcacacagattttagtaaggactacaacctagaggttatttgtgctccagtatgttgcaggctgaaga
cgctggtagaaatccagaaattgaggttcaggcaggaggagacaatgagagaggctcttcaggaggatcaagaagcgaaa
atactctcctga
>gnl|bcl2dbcds|Q9WA49_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Porcine adenovirus A serotype 3 (length=609 residues).
atggactatcaacttctggccaagcttactaacgtgaactaccttaggaaggtgatagtacaggggtctcagaactgccc
ttggtggaaaaagattttttcggacaggtttatcaaggtagtagcagaggccaggaggcagtacgggcaagagttgattg
agatttttgtggagggtgagaggggctttggtcctgagttcctgcgggaagggggactgtacgaagaggccgttctgaaa
gagttggatttcagcaccttgggacgcaccgtagctagtgtggctctggtctgcttcatttttgagaagcttcagaagca
cagcgggtggactgacgagggtattttaagtcttctggtgccgccactatgttccctgctggaggcgcgaatgatggcgg
agcaggtgcggcaggggctgtgcatcatcaggatgccgagcgcggagcgggagatgctgttgcccagtgggtcatccggc
agtggcagcggggccgggatgcgggaccaggtggtgcccaagcgcccgcgggagcaggaagaggaggaggaggacgagga
tgggatggaagcgagcgggcgcaggctcgaagggccggatctggtttag
>gnl|bcl2dbcds|A0A0K0MGC6_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Skunk adenovirus PB1 (length=549 residues).
atggatatcttacaattgtgttcctcctatagccagtttaggggcattattcgcgggaccacctatagggccgggtgggt
tagaagatggtgttttcaccccctcacagatattgttgcaaacctagctgaggattttgatactagatattggctagcct
tgcctctgggtcacccctattgggagttgcttaagaggggctataccttcgcaggcaacccagacctctttgggggagtg
gacctgtccactcggggaagggccttagcatttttgggctttttaacctttattctgcgtaattggcctcctgattctgt
agtgccctccgaagcaagaattgacctggtctgtgtcccagcatggaccaaaatccaaatgtggacgcagaccctgcagc
tgctcgaggaaatgcaaaccgcgcgggccatgccagaagaagaagaagaggggctcacgtcgccctcggacgaggaggtc
gcttcagactcaacagaccagccggacccccacagcgacgaggaccctttccccccggagacggagtga
>gnl|bcl2dbcds|A0A240FBF7_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Squirrel adenovirus 1 (length=432 residues).
atggaaatcgctccttttagacatctttcttacttgcgtagaattttaaaatgtgcttccaatagagcttcatggtttga
attactgtttatggataaatttacttcattagttagacaagttaaaattgagaaatctgcggaattgcaggaaatgttgg
agtcttgttcttttttagataaacctgttattgaaatgcttaaactcggttacactgtgggtttacgctacattgttaat
gctgaggttgatgtttccagtcctggccgtctggtcgcttctatggcttttttggctcatgttatggatgtgtgggaaaa
aaacagtgattttttaccagattttattttggattctgtagcgataacattatggcagatgatcaatttccgcttgaagg
caatggagttgggggaggaagaaggagagtaa
>gnl|bcl2dbcds|P04886_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Tree shrew adenovirus serotype 1 (length=414 residues).
atggactttttaaagccattttgccaatacaaggtgcttaaatctgtggtggtgggtgcttctaatcaatcttcggtggt
gtctaggttctttgggcctaagattactaagttaatttattcaactaaagtttctaatcgtgatcaatttttagactcgc
ttccacgcggttacttggacggcttggctagtggtgatttttctaaaattgatttattggtggagcagcttgattttacc
tctgctgggcgtttaactgctagtctgagccttttggtgttagtggttgaagagtggtctgctcgctcttgcgtttcttt
tgatattttaactgaattacttcttgtgccggcatggcgcaaaataatagcgacggcgtggaaggggcgagccccgccaa
gcgccgacgtttag
>gnl|bcl2dbcds|Q77M91_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Tree shrew adenovirus serotype 1 (length=414 residues).
atggactttttaaagccattttgccaatacaaggtgcttaaatctgtggtggtgggtgcttctaatcaatcttcggtggt
gtctaggttctttgggcctaagattactaagttaatttattcaactaaagtttctaatcgtgatcaatttttagactcgc
ttccacgcggttacttggacggcttggctagtggtgatttttctaaaattgatttattggtggagcagcttgattttacc
tctgctgggcgtttaactgctagtctgagccttttggtgttagtggttgaagagtggtctgctcgctcttgcgtttcttt
tgatattttaactgaattacttcttgtgccggcatggcgcaaaataatagcgacggcgtggaaggggcgagccccgccaa
gcgccgacgtttag
© 1998-2018