Dataset for CDS adenoviridae of organism Simian mastadenovirus WIV19

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1L3INW0_E1B19K-01 E1B19K gene OS=[Viruses] Simian mastadenovirus WIV19 GN=E1B19K (length=543 residues).
atggacttgtacaagagcttagaggatcgcagcactttgcgacagctgctggaggaggcatccaactctacctcttactg
ctggaggtttttgtttggatcccctctgggtcgctttttgtaccgggttaagaaggatcatcaggaggaatttgatcagt
taattggtctttttcctactattttcgagtctcttaacctcggtcacaaaactcttctcgaggataagctcctggtgcag
ttggatttttcaactccaggacgcgcctgttcaggtcttgcctttgttgtgcatttactggacagatggaaccaggagac
gtacctgagcccggggtacaccctggattttttgacgctgagcctgtggaagacagggctgaagaggggcaggaagcttt
acgggagaatgttagagcgccatccttcgctgatccagaagaccgtgcgagctcaggttctgtcgcggtggggagccctg
gagaacctagccgaggaggaccctcgagcggggctggaccctccggaggaggaggtggactag
© 1998-2018