Dataset for CDS E1B19K of organism Simian mastadenovirus C

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|M9YVF6_E1B19K-01 E1B19K gene OS=[Viruses] Simian mastadenovirus C GN=E1B19K (length=495 residues).
atggatctcctaaggctgctcagcgattacgaggtgctgcgcaagttgctggagacagcctgtgagaaaaatcgcagctg
ttggaggtttttctttggctctactcttagcaacgtggtgcacagagtcaagcgagagcacagtgaagaattttctagac
tagtggcagatgttcccgggctttttgtttctttagatttaggacatcactcttactttcaggagaagattgtcaagggt
ctagtgtttgagtcaactggccgcacggttgtgtctgtggcttttatctgttttcttttggataaatggagcagcgacag
ccacctgtcgtgggattacatgctggattacatgaccatggcgttgtggcgggcgctcctgaggaggaggagggcttgca
tttacttgccggtgcagcctcagcaaggtctggagcgagtggaggaagaggaggaggagaacccgagggcaggcgtggac
cctcctctggaatag
>gnl|bcl2dbcds|M9YXY5_E1B19K-01 E1B19K gene OS=[Viruses] Simian mastadenovirus C GN=E1B19K (length=501 residues).
atggatctcctaaggttgctcagtgattacgaggtgctgcgcaagttgctggagacagcctgtgagaaaacttccagctg
ttggaggtttttctttggctctactcttagcaacgtggtgcacagagtcaagcgagagcacagtgaggaattttctagac
tagtggcagatgttcccgggctttttgtttctttagacttaggacatcactcttactttcaggagaaaattgtaaagggt
ctagtgtttgagtcaactggccgcacggttgtgtccgtggcttttatctgttttcttttggataaatggagcagcgacag
ccacctgtcgtgggattacatgctggattacatgaccatggcgctgtggcgggcgctcctgaggaggaggagggcttgca
tttacttgccggtgcagcctcagcgaggtctggagcgagtggaggaagaggaggaggagaacgagaacccgagggccggc
gtggaccctcctctggaatag
© 1998-2018