Dataset for CDS E1B19K of organism Simian adenovirus serotype 7

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|P06501_E1B19K-01 E1B19K gene OS=[Viruses] Simian adenovirus serotype 7 GN=E1B19K (length=543 residues).
atggatctccgaacggcgcttcagacttttgagagcacccgccgcttgctggagctctgttccaatagaacctctttttt
gtggaggtggttatttggaactccgctcagccggctggttaggcaggtgaaattagaatacgagaaggattttgaaagaa
ttttagatcagtgtcccggggtgtttgagtccctggagctgggctatcataaggtttttgaggagaagattgtaaaggag
ttggatttttcttctcccggtcgggcggtcgcggctgtggcctttgcttcctacctgctggatagatggaacacccggac
ccacctgtccccggggtaccagatggattacatcagcctgaacctgtggaagttttggttgcgccggcgggtttacaatt
actcgcgggggctgcctcagctagggccggcggcgccgctggcgaggcaggggtcgcagcaggaggagcagcagcagcgg
caggaggaggagcaggtgcaggaggagatgaggtccggcctggaccctccaacggagaactga
© 1998-2018