Dataset for CDS adenoviridae of organism Simian adenovirus A1327

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H9AAV3_E1B19K-01 E1B19K gene OS=[Viruses] Simian adenovirus A1327 GN=E1B19K (length=636 residues).
atgattaacgatgtgaactttgtctgtttattcaaaggggattacctgggaggtataaagggagcggtggtgaggttggg
gcatttcaccatggatctgcgagtggagttgcagacttttgagagtacccggtgcttgctggagctgtgctccaacagag
cctcttggtggaagaggcttttgtttggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccagagcgag
tttgagcatattctttccacttgccaggggcttttcgagtctctggagttgggtcaccacacggtgtttcaggagaaaat
tgtgaaggctttggatttttcctctccgggcagggcagtcgcggccattgcttttgccgcctttattttggatagatgga
acacccagacccagctgtccccggggtacaccctggattacatcagcctgcagctgtggaggttctggctgcgccggcgg
gtttacaactactcgcgggggctgcctccgctcgggcgggcatcgtcgccggaggagcagtcgccggaggtgaagccgga
ggtggcggggcagggggaggagcaggagcaggagccagcgctgcggtccggcctggaccctccggaggagaattaa
© 1998-2018