Dataset for CDS adenoviridae of organism Simian adenovirus A1285

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H9AAK5_E1B19K-01 E1B19K gene OS=[Viruses] Simian adenovirus A1285 GN=E1B19K (length=654 residues).
atgattaacggctgtgaactttggttgtttattcaaaggggattacctgggaggtataaagggagcggctttcaggctag
aggcatttacccactagccgccttcatggatctgcgcgctgagctgcaaacttttgagagtacccggcgtttagtagagt
tgtgctccaacaggtcctcttggtttgggaggttcctgtttggaagcactctctgccgggtggtaaggcaggtgaaggag
gagtatcagagcgagtttgaacacattctttccaactgccctgggctttttgtgtctttggatctgggccaccatacggt
gtttcaggagaagattgtgaaggctttagatttttcttctccgggcagagccgttgcggctattgcttttgccgcctttt
tgctggatagatggaacgcccagacccagctgtccccggggtacaccctggattacatcagcttgcagctgtggaggttt
tggctgcgccggcgggtttacaactactcgcgggggctgcctccgctcgggctggcgtcggtggcggaggagcgttcgga
ggaatccaagccggaggtgaacccggaggcgcagggggaggcgaaggaggaaacgctgcggtccggcctggaccctccgg
tggaggagaactag
© 1998-2018