Dataset for CDS E1B19K of organism Simian adenovirus A1139

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H9AA76_E1B19K-01 E1B19K gene OS=[Viruses] Simian adenovirus A1139 GN=E1B19K (length=636 residues).
atgattaacgatgtgaactttgtctgtttattcaaaggggattacctgggaggtataaagggagtggtggtgaggttggg
gcatttcaccatggatctgcgagtggagttgcagacttttgagagtacccggtgcttgctggagctgtgctccaacagag
cctcttggtggaagaggcttttgtttggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccagagcgag
tttgagcatattctctccacctgccaggggcttttcgagtctctggagttgggtcaccacacggtgtttcaggagaaaat
tgtgaaggctttggatttttcctctccgggcagggcagtcgcggccatcgcttttgccgcctttattttggatagatgga
acacccagacccagctgtccccggggtacaccctggattacatcagcctgcagctgtggaggttctggctgcgccggcgg
gtttacaactactcgcgggggctgcctccgctcgggcgggcatcgtcgccggaggagcagtcgccggaggtgaagccgga
ggtggcggggcagggggaggagcaggagccggagccagcgctgcggtccggcctggaccctccggaggagaattaa
© 1998-2018