Dataset for CDS E1B19K of organism Simian adenovirus 3

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q695T5_E1B19K-01 E1B19K gene OS=[Viruses] Simian adenovirus 3 GN=E1B19K (length=558 residues).
atggacttgtacgagagcctagagaatctaagttctttgcgacgtttgctggaggaggcctccgacagaacctcttacat
ttggaggtttctgttcggttcccctctgagtcgctttctttaccgggtgaagcgagagcacctgacggaatttgatgggc
ttttagagcagctgcctgggctgtttgattctttgaatctcggccaccggacgctgctagaggagaggctttttccacaa
ttggacttttcctctccaggccgtctgtgttccgcgcttgcttttgctgtacatctgttggacagatggaacgagcagac
gcagctcagcccgggttatactctggacttcctgacgctatgcctatggaagttcggaatcaggagggggaggaagctgt
acgggcgcttggtggagaggcatccgtctctgcgccagcagcgtctgcaagctcaagtgctgctgaggcgggaggatctg
gaagccatttcggaggaggagagcggcatggaagagaagaatccgagagcggggctggaccctccggcggaggagtag
© 1998-2018