Dataset for CDS E1B19K of organism Simian adenovirus 13

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A0M3TH18_E1B19K-01 E1B19K gene OS=[Viruses] Simian adenovirus 13 GN=E1B19K (length=564 residues).
atgaagaggcctgtggctgcagaagtccaaatggagcttgacaggctgttagagaattataacagcttaagaagggtttt
agaagaggcgtctgaagatacttcagtttggtggcgcaagttgtttgggtgtagagttagtcagttagtagttcaggcta
aagttgaatataaggaagaatttgagaaacttttttcagaggtgcctggacttgtggactctctaaatttttgccatcac
gcttttttttacgagaaggttatttgcggcttggatttttgcactcccggacgcactattgcagctttggctttttgcgc
ttttattttagataagtggaataaggagactcatctcagtaaaggatatactttagattacattagtttgcagctatgga
aggcttacatgaggaaggggaagatctacaccttctcgcaggggccgcggtcgctgccgcagcgggtgcggaggcggttg
gggttcaagacagaggaccaaacgcgcttgctggaggccgaggaggagcccagggcggggacggatcccccgagcgagac
ttga
>gnl|bcl2dbcds|A0A1W5PVU4_E1B19K-01 E1B19K gene OS=[Viruses] Simian adenovirus 13 GN=E1B19K (length=567 residues).
atgatgaagaggcctgtggctgcagaagtccaaatggagcttgacaggctgttagagaattataacagtttaagaagggt
tttagaagaggcgtctgaggatacttcagtttggtggcgtaggctgtttgggtgtagggttagtcagttagtagtgcagg
ctaaagttgaatataaggaagaatttgagaaacttttttcggaagtgcctggacttgtggactctttgaatttttgccat
cacgcttttttttacgagaaggttatttgcggcttggatttttgtactcctggacgcactattgcagctttggctttttg
tgcttttattttagataagtggaataaggagactcatctgagtagaggatatactttagattacattagtttgcagctat
ggaaggcttacatgaggaaggggaagatctacacattctcgcaggggccgcggtcgctgccgcagcgggtgcggaggcgg
ctggggttccagacagaggatcaaacccgcttgctggaggccgaggaggagccccgggcgggaatggatcccccgagcga
gacttga
© 1998-2018