Dataset for CDS E1B19K of organism Rhesus adenovirus 57

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2H5AI72_E1B19K-01 E1B19K gene OS=[Viruses] Rhesus adenovirus 57 GN=E1B19K (length=507 residues).
atggatctgctaggagacctgagggaatttggcgtggttcggcgcttgctggagttggcctctgacagaacttccaagtt
ttggaggttttgttttggctcaacgcttagcaacgtgctatatagggtcaagaaggagcaggagacgcagtttgctaggc
tgttggccgatactcctggagtttttgtggctctggatctaggccatcactctcttttccaagagaaaattatcaaaaac
ttaacttttacgtctcctggtcgcacggttgcttccgctgcctttattacctatattttggatcaatggagcaacagcgg
cagtcacctgtcgtgggagtacatgctggattacatgtcgatggcgctgtggagggccatgctgcggaggagggtttgca
tttacttgcgggcgcagcctccgcggctggaccgagtggaggaggaggacgagccgggggagaccgagaacctgagggcc
gggctggaccctccaacggaggactag
© 1998-2018