Dataset for CDS adenoviridae of organism Rhesus adenovirus 56

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2H5AI40_E1B19K-01 E1B19K gene OS=[Viruses] Rhesus adenovirus 56 GN=E1B19K (length=534 residues).
atgggaagtgagagcacagctgccttaatggatctcttggggaacttgagggaatttgacgtggttcgccgcttgctgga
gttggcctctgacaaaacttccaggctttggaggttttggtttggctcaacgcttagcagcgtagtttatagagtaaaaa
gagagcaggaggcgcagtttgctaggctgttggccgagactcctggagttcttgtggctctggatctaggccatcactct
ctttttcaagaaaaaatcatcagaaacttaactttttcgtctcctggccgcacggttgcttccgcagcctttgttgccta
tattttggatcaatggagcaacagcaacagccacctgtcgtgggagtacatgctggattacatggcgatggctctgtgga
gggccatgctgcggaggagggtttgcatttacttgcgggcgcagcctccgcggctggaccgagtggtggaggagaacgag
ccggaggagaccgagaatctgagagccggcctggaccctccagtggaagactag
© 1998-2018