Dataset for CDS Unclassified of organism Porcine adenovirus A serotype 3

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q9WA49_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Porcine adenovirus A serotype 3 (length=609 residues).
atggactatcaacttctggccaagcttactaacgtgaactaccttaggaaggtgatagtacaggggtctcagaactgccc
ttggtggaaaaagattttttcggacaggtttatcaaggtagtagcagaggccaggaggcagtacgggcaagagttgattg
agatttttgtggagggtgagaggggctttggtcctgagttcctgcgggaagggggactgtacgaagaggccgttctgaaa
gagttggatttcagcaccttgggacgcaccgtagctagtgtggctctggtctgcttcatttttgagaagcttcagaagca
cagcgggtggactgacgagggtattttaagtcttctggtgccgccactatgttccctgctggaggcgcgaatgatggcgg
agcaggtgcggcaggggctgtgcatcatcaggatgccgagcgcggagcgggagatgctgttgcccagtgggtcatccggc
agtggcagcggggccgggatgcgggaccaggtggtgcccaagcgcccgcgggagcaggaagaggaggaggaggacgagga
tgggatggaagcgagcgggcgcaggctcgaagggccggatctggtttag
© 1998-2018