Dataset for CDS Unclassified of organism Porcine adenovirus 5

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q994F2_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Porcine adenovirus 5 (length=492 residues).
atggagcttgaactaagcttgaagctctgcaagaccctctgcgattttaagaacctgactcgggtcgtctattatgcttc
tgacagaccaggttggctctctcgctatttctttgggggcagactcgctcaattagtttataaggccaaggttgactacc
accagacactgactgaactgtttgaggatgatcagagcttttggtgtttgttagagagtgggagaacgctgggattcgag
gcaaaggtggtgccgtggttagatttttcatcaactggtagggttgtttctagtttgtcattattggcatacttggtaga
ccaccttgattgtcacacagattttagtaaggactacaacctagaggttatttgtgctccagtatgttgcaggctgaaga
cgctggtagaaatccagaaattgaggttcaggcaggaggagacaatgagagaggctcttcaggaggatcaagaagcgaaa
atactctcctga
© 1998-2018