Dataset for CDS Unclassified of organism Murine adenovirus 2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E7CH29_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Murine adenovirus 2 (length=1002 residues).
atggatctgttaaagcatttgagcgaatataaggtgttgagagatttagtcttggagagttcttctttcaagccgtggtg
gtggagacgtagggggttatcgaatctggttcgagaaacgatagaaaagttcagaacggagtacgaagaagtgctcggtc
aggtcttttttactcgtttgaatcatcaagacttttttctttaccactacgtgattcgcgaagaattagatctgagtact
ccgggtcatcagatttccggcatctctttcgtggtgtatgtgctcgagcgttgggcgctgttggagcaacgtttcgggcg
tgattacttggtagactccctggtgtttcccctgtatcagcgggtgcgctcggagctgagatggcagagcagacaagttc
tcaagccggtgcgtcgcttcaggcggagccaggctcttccggcggagcagcggcagtcgatgccgtttccctttcagggg
gatcggccgacggagccccttcttcccagcttcaggctgagccgttcgagccctccgtctccgaaccgtccgcagagtcc
gttgccagccctggtggtgaatcagtcgagtcgggtccctccgccctcgaacgcgaccgcagcggctccggggtgccctc
cgccaccgacagtgatgataccgacatcgaaaagtctccggccgcggtcgtgccccagtggcgcgatttttacgtcttcg
agcatcgacccgaacccgagccagcggacgtccccgccccggccgccgccgaagctgtaccagcaccagtaccagaacct
gatgctgagcgagacgacctcggagatggcgagcctgacggtgtcgtccccgacgccgccgctgccgccgatgcccccca
cggagacgccggtcgagaaggcgaggaggggcagcagcgacagcctcagttccgagcgcgaggggtcatatcggaaagtc
ccgggtacgccggctcggtgccggagggcgttgcagctatag
© 1998-2018