Dataset for CDS E1B19K of organism Human mastadenovirus C

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A0G2R248_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=531 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcatcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcgataataccgacggaggagcagcagcagcagcaggaggaagccaggcggcggcgg
caggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|A0A291P1B2_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=528 residues).
atggagacttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcattaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacagcaggaggaagccaggcggcggcggcggcag
gagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|A0A2H4PJ75_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=537 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcagcagcagcagcagcaggaggaagccaggcggcgg
cggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|E1ARN8_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=543 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcctggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatttgtggagagcggtggtgagacacaagaatcgcctac
tactgttgtcttccgtccgcccggcaataataccgacggaggagcagcagcagcaacagcagcagcaggaggaagccagg
cggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|J7I6T8_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=540 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcagcagcagcagcagcagcaggaggaagccaggcgg
cggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|J9Z4H6_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=546 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaagagcagcagcagcagcagcagcagcagcaggaggaagcc
aggcggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|J9Z4N4_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=534 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgttggaacagagctctaacagtacctcctggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatttgtggagagcagtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcagcagcagcagcaggaggaagccaggcggcggcgg
cggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|J9Z5H0_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=528 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacagcaggaggaagccaggcggcggcggcggcag
gagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|T1UG63_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus C GN=E1B19K (length=546 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtttgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcactgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcagcagcagcagcagcagcagcaggaggaagccagg
cggcggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
© 1998-2018