Dataset for CDS adenoviridae of organism Human mastadenovirus B

[Download (right click)] [Alignment] [Repertoires]

16 sequence(s)

>gnl|bcl2dbcds|A0A0K0PX35_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=546 residues).
atggaggtttgggctatcttggaagaccttagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtctttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggccatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcctttcttacttttatattggataaatggatccgccaaac
ccacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggcgtagcagggatcctgagacacccacctgccatgccatcggttctggag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggaggcggaggagtag
>gnl|bcl2dbcds|A0A0K0PX99_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=546 residues).
atggaggtttgggctatcttggaagaccttagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtctttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcctttcttacttttatattggataaatggatccgccaaac
ccacttcagcaggggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggcgtagcagggatcctgagacacccaccggcaatgccagcggttctggag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggaggcggaggagtag
>gnl|bcl2dbcds|A0A1L7NRH1_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttagaaagactaggcaactgttagaggacgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaagaagaatttgaaaagt
tgttgctagattgcccaggactttttgaagctcttaatttgggtcatcaagttcactttaaagaaaaagttttatcagtt
ttagacttttcaaccccaggtagaactgccgctgctgtggcttttcttacttttatattagataaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcatagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatgccagcggttctggag
gaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtag
>gnl|bcl2dbcds|I6LEP5_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcgggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|I6LES1_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|J7I6Q4_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|J7I6S4_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|J7I6W7_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttagaaagactaggcaactgttagagaacgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaagaagaatttgaaaagt
tgttggtagattgcccaggactttttgaagctcttaatttgggtcatcaagttcactttaaagaaaaagttttatcagtt
ttagacttttcgaccccaggtagaactgccgctgctgtggcttttcttacttttatattagataaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatgccagcggttctggag
gaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtag
>gnl|bcl2dbcds|J7ID56_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcaaacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|Q5UW22_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttaggaagactaggcaactgttagagaacgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaacaagaatttgaaaagt
tgttggtagattgcccaggactttttgaagctcttaatttgggccatcaggttcactttaaagaaaaagttttatcagtt
ttagacttttcaaccccaggtagaactgctgctgctgtggcttttcttacttttatattagataaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcatagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatgccagcggttctggag
gaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtag
>gnl|bcl2dbcds|T1UE63_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttaggaagactaggcaactgttagagagcgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaacaagaatttgaaaagt
tgttggtagattgcccaggactttttgaagctcttaatttgggccatcaggttcactttaaagaaaaagttttatcagtt
ttagacttttcaaccccaggtagaactgctgctgctgtggcttttcttacttttatattagataaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcatagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatgccagcggttctggag
gaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtag
>gnl|bcl2dbcds|T1UF50_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=537 residues).
atgaaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|T1UFS4_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttagaaagactaggcaactgttagaggacgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaagaagaatttgaaaagt
tgttggtagattgcccaggactttttgaagctcttaatttgggccatcaagttcactttaaagaaaaagttttatcagtt
ttagacttttcaaccccaggtagaactgccgctgctgtggcttttcttacttttatattagataaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatgccagcggttctggag
gaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtag
>gnl|bcl2dbcds|T1UIP3_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctgagacagactaggctactgctagaaaacgcctcggacggagtctctggctt
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggccatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
ccacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccggccatgccagcggttctggag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|T1UJX4_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttaggaagactaggcaactgttggagaacgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaagaagaatttgaaaagt
tgttggtagattgcccaggactttttgaagctcttaatttgggccaccaggttcactttaaagaaaaagttttatcagtt
ttagacttttcaaccccaggtagaactgccgctgctgtggcttttcttacttttatattagacaaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcatagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccacctgtcatgccagcggttctggag
gaggaacagcaagaggacaatccgagagccggcctggaccctccagtggaggaggcggagtag
>gnl|bcl2dbcds|T2CI10_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus B GN=E1B19K (length=546 residues).
atggaggtttgggccatcttggaagatcttaggcagactaggcaactgctagaaaacgcctcggacggagtctctggtct
ttggagattctggttcggtggtgatctggctagactagtctttagaataaaacaggattacaggcaagaatttgaaaagt
tattggacgactgtccaggactttttgaagctcttaacttgggccaccaggctcattttaaggagaaggttttatcagtt
ttggatttttctacccctggtagaactgctgctgctgtagctttccttacattcatatttgataaatggatcccacagac
ccacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtacagcctctgggcgtagcagggatcctgagacacccaccgaccatgccagcggttttggag
gaggagcaccaagaggacaatccgagagtcggcctggaccctccggtggaggaggcggaggagtag
© 1998-2018