Dataset for CDS E1B19K of organism Human adenovirus F serotype 41

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A1S6ELT2_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=513 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatatttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggctctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggagagggagaacctg
agggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|B5SNR1_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=513 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggagggatatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggaggaggagaacctg
agggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|F4ZCJ8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=516 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggaggaggaggagaac
ctgagggccggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|P10544_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=507 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggagggatatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggagaacctgagggcc
ggtctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|W0S1G8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus F serotype 41 GN=E1B19K (length=507 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggaggagaacctgagggcc
ggtctggatcctcaaacggaattgtaa
© 1998-2018