Dataset for CDS E1B19K of organism Human adenovirus E serotype 4

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|P10406_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=429 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctctcacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctagtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|Q2KSG6_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=552 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcccaggaacgccaacgc
cgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggaggaggagtag
>gnl|bcl2dbcds|Q2KSG6_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=420 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctgccggtacagccgctag
>gnl|bcl2dbcds|Q2KSM8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=555 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcccaggaacgccaacgc
cgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggaggaggaggagtag
>gnl|bcl2dbcds|Q2KSM8_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=429 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|Q5GFC7_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=429 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctcttacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|Q5GFC8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=516 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctcttacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggaggatcaagaagagaat
ccgagagccggcctggaccctccggcggaggagtag
© 1998-2018