Dataset for CDS adenoviridae of organism Human adenovirus B serotype 7

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A220VZ73_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctgcttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|I1V161_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|P03248_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctaggagtagcagggatactgagacacccacctaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|Q5EY83_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactactagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacattccaggactttttgaagctcttaacttgggccatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|Q6RK98_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
© 1998-2018