Dataset for CDS E1B19K of organism Human adenovirus A serotype 18

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|D3JIR7_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus A serotype 18 GN=E1B19K (length=489 residues).
atggagttggaagctgtgctgcaaagttatcagggcgttcgtcagctcttacagtatacctctaaaaacacttcaggttt
ttggagatatctgtttgggtctactttatgcaaagtggtacatagggtaaaagaagactacaggaaggaatttgaaaaca
tactggccggctgtccagggcttttggcatctttagatctttgccaccactcgatttttcaagagaaagtggtcaaatct
ttggatttttcatctgcagggcgaacggttgcttctattgcttttttggtaaccgttttagataaatggagccagacgtc
ccagctgagttgggattacatgctggattacatggcaatgcagctgtggagggcatggctcacgaggagggtttgcattt
actcgctggcgcggcctttgaccatgccgcgactgccaacgttgcaggaggaggagctggagcagcgggaccctgcggcg
gagaagtga
© 1998-2018