Dataset for CDS E1B19K of organism Human adenovirus A serotype 12

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|P04492_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus A serotype 12 GN=E1B19K (length=492 residues).
atggagttggaaactgtgctgcaaagttttcagagcgttcgccagctcttgcagtatacctctaaaaacacttcaggttt
ttggaggtatctgtttggctctaccttaagcaaggtggtaaatagggtgaaagaagactatagagaggaatttgaaaaca
tattggccgactgtccagggcttttggcttcactagacttgtgttaccacttggtgtttcaggaaaaagtggtcagatcc
ttagatttttcatctgtgggacgaacggttgcttctattgcttttttggcaaccatattggataaatggagcgagaaatc
ccacctgagttgggattacatgctggattacatgtcaatgcagctgtggagggcatggctgaagaggagggtttgcattt
actcgctggcgcggcctttgaccatgccgccgctgccgacgttgcaagaggagaaggaggaggagcggaaccctgcggtg
gtggagaagtaa
© 1998-2018