Dataset for CDS adenoviridae of organism Human adenovirus 7d2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|R4HMC6_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 7d2 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
© 1998-2018