Dataset for CDS adenoviridae of organism Human adenovirus 53

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|E5RWD9_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 53 GN=E1B19K (length=549 residues).
atggatgtgtggactatccttgcagactttagcaagacacgccgacttgtagaggatagttcagacgggtgctccgggtt
ctggagacactggtttggaactcctctatctcgtctggtgtacacagttaagaaggattataacgaggaatttgaaaatc
tttttgctgattgctctggcctgctagattctctgaatctcggccaccagtcccttttccaggaaagggtactccacagc
cttgatttttccagcccagggcgcactacagccggggttgcttgtgtggtttttctggttgacaaatggagccagaacac
ccaactgagcaggggctacattctggacttcgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
tcttgaactactggcttatacagccagcagctccgggtcttcttcgtctacacagacaaacatccatgttggaggaagaa
atgaggcaggccatggacgagaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
>gnl|bcl2dbcds|E5RWL1_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 53 GN=E1B19K (length=549 residues).
atggatgtgtggactatccttgcagactttagcaagacacgccgacttgtagaggatagttcagacgggtgctccgggtt
ctggagacactggtttggaactcctctatctcgtctggtgtacacagttaagaaggattataacgaggaatttgaaaatc
tttttgctgattgctctggcctgctagattctctgaatctcggccaccagtcccttttccaggaaagggtactccacagc
cttgatttttccagcccagggcgcactacagccggggttgcttttgtggtttttctggttgacaaatggagccagaacac
ccaactgagcaggggctacattctggacttcgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
tcttgaactactggcttatacagccagcagctccgggtcttcttcgtctacacagacaaacatccatgttggaggaagaa
atgaggcaggccatggacgagaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
© 1998-2018