Dataset for CDS adenoviridae of organism Human adenovirus 39

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|M0QV87_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 39 GN=E1B19K (length=549 residues).
atggatgtgtggactatccttggggattttgtcaagacacgccggcttgtagaggatagttcagacgggtgctccgggtt
ctggagacactggtttggaactcctttatctcgcctggtgtacacagttaagaaggattatagcgaggaatttgaaaatc
ttttttccgactgctctggcctgctagattctctgaattttggccaccagtcccttttccaggaaagggtccttcacagc
cttgatttttcaactcccgggcgcactacagccggggttgcttttgtggtttttctggttgacaaatggagccaggacac
ccaactgagcaggggctacatcctggacttcgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
tcttgaactactggcttctacagccagcagttccgggtcttcttcgtctacacagacaaacatccatgttggaggaagag
atgagggaggccatggacgagaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
© 1998-2018