Dataset for CDS E1B19K of organism Human adenovirus 34

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q3ZL02_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 34 GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttagaaagactaggcaactgttagaggacgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaagaagaatttgaaaagt
tgttggtagattgcccaggactttttgaagctcttaatttgggccatcaagttcactttaaagaaaaagttttatcagtt
ttagacttttcaaccccaggtagaactgccgctgctgtggcttttcttacttttatattagataaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatgccagcggttctggag
gaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtag
© 1998-2018