Dataset for CDS E1B19K of organism Human adenovirus 25

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|M0QUJ3_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 25 GN=E1B19K (length=549 residues).
atggatgtgtggactatccttgcagactttagcaagacacgccggcttgtagaggatagttcagacgggtgctccgggtt
ctggagacactggtttggaactcctctatctcgcctggtgtacacagttaagaaggattataaagaggaatttgaaaata
tttttgctgactgctctggcctgctagattctctgaatcttggccaccagtcccttttccaggaaagggtactccacagc
cttgatttttccagtccagggcgcactacagccggggttgcttttgtggtttttctggttgacaaatggagccaggacac
ccaactgagcaggggatacatcctggacttcgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
tcttgaactactggcttctacagccagcagctccgggtcttcttcgtctacacagacaaacatccatgttggaggaagaa
atgaggcaggccatggacgagaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
© 1998-2018