Dataset for CDS Unclassified of organism Equine adenovirus B serotype 2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0K1DBT8_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Equine adenovirus B serotype 2 (length=417 residues).
atggatctgatgaagcttttagatttcaaagagtttaaacgctgtgtctatttagcatctaataggtgtaggtggtggga
gaagattttctgtactcggttcattaaatttgtgcgtcagataaaaaaagagaattttctagagtttgctgaacttatcc
tctgtaacacagctttttcaagttgtctaaagtctggacaggtgtctctttttcataatactgtgttatgtgaacttgac
ttttccaaccctgggcgtgttgtcactaacctggcctttttgtcatatttgattgatatgtgggatcaggttgatgtatt
ttcccatgaatttattttggagtctgtctgctttccagcatggcagcgattcaaccagactcagccgaagggggtgttga
agagcacagaagtgtga
© 1998-2018