Dataset for CDS Unclassified of organism Equine adenovirus A serotype 1

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A1B0XB89_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Equine adenovirus A serotype 1 (length=786 residues).
atgcaacagaggacgcggaaactgagacagcggatgaggaggccggtcacgatgaccaggcgtggtgctccgggggcgtg
gcggaacaagaggagcccttggacctgtctgtcagacactcccgttaaatcagaaaataaaaaacagatttgtggtcacg
caacgggagtggtcgtcttacttataagcgcgtgtttggtttggcttcttcacttgcttttcaggcagggtttgggggag
gtaggcatggaggttttgaattattgcagaaactactatgagtttaggaggatgataaaggggactacttactctctggg
gtgggttaggaggtggcttttctctcctctgtcagatgtggtgtgcatggtggctgagaaaaacgagctggcttactgga
gggcgctgcctccgagccacttttactgggatatgctgaagagggggcacgctttcttcgggaaagaagacctgtttgct
tgtgttgatctatctacggggggtcgtgtgcttgcttccctaggcttcctggcttttgtgttgcgccactggccccgcga
ctctgttgtcccttttgagcagaggttggatttgatttgcgccccagcatggacccgaatgcagatgtggatccaaatgg
aagagagccgggccctcgagcagcagcagccgcccgaggagaccatagaggaggaggaggaaacctccgacgcggaggaa
acggggtcgatggaggggctagaagacagcgacgaggaagacctcgaatccttggtggtccggtaa
>gnl|bcl2dbcds|G5CZ72_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Equine adenovirus A serotype 1 (length=540 residues).
atggaggttttgaattattgcagaaactactatgagtttaggaggatgataaaggggactacttactctctggggtgggt
taggaggtggcttttctctcctctgtcagatgtggtgtgcatggtggctgagaaaaacgagctggcttactggagggcgc
tgcctccgagccacttttactgggatatgctgaagagggggcacgctttcttcgggaaagaagacctgtttgcttgtgtt
gatctatctacggggggtcgtgtgcttgcttccctaggcttcctggcttttgtgttgcgccactggccccgcgactctgt
tgtcccttttgagcagaggttggatttgatttgcgccccagcatggacccgaatgcagatgtggatccaaatggaagaga
gccgggccctcgagcagcagcagccgcccgaggagaccatagaggaggaggaggaaacctccgacgcggaggaaacgggg
tcgatggaggggctagaagacagcgacgaggaagacctcgaatccttggtggtccggtaa
© 1998-2018