Dataset for CDS Unclassified of organism Eidolon helvum adenovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A348FKF5_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Eidolon helvum adenovirus (length=486 residues).
atggagcgtcctgaggagattcctttctgcttcgaaaccacaaaaaaccttttgctccagacctataaattttctaagtc
aaattggttttggagaaagtttttttctccaccttttatttttgcggttttggaggcgagaaaaacttacaaagaagagt
ttcaaggaaacttaaatgcggatctctgcattaatgttttctttgatactctagattggggaaattttcaaaattctttg
atccggcatttggatttttcaagttttggaagggctgtagcaagtattgcttttttatcaactattattgaaagattgga
agaagttacttgtttttctgttccttttattattgaaagttttagctacgctatttggcaatgggcgatctcatcgaaga
agtcgccgacatcccggttgaaaacatcccgcctaaccaagacgcaggagaaggcgatggaagagctcagcaagagcttg
ctttaa
© 1998-2019