Dataset for CDS Unclassified of organism Deer mastadenovirus B

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1Y0B6F3_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Deer mastadenovirus B (length=474 residues).
atggatcatttagatattctgatagatttgaggctattgcgctccgtgatagcgggggcctcaaatcgaactggcgcctg
gaaaagaagattgtggctggggcgcttaactcaactggttcataacatttgctcggagaaccaggagagctttttaaact
ctctacctgggaatgctaattttctgaggctgctacgaacgggctattttgaagtttacgacgtctttgtggttcctgag
ctgcatttggattctcctggacgggtggttgctgctttggctcttctggtcttcattctcaacgatttggatgcgcattc
tgctgcttcaggcttcgattcaggtttcctaatcgatcgcctctgtgtgccgttatggctcaaggcccgggcatacaaga
tcacccagagctccaggaccaatttgcagccttcctcatcgccagacaagacgaccccgacttccagccaatag
© 1998-2019