Dataset for CDS adenoviridae of organism Cynomolgus adenovirus 1

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1C8EG46_E1B19K-01 E1B19K gene OS=[Viruses] Cynomolgus adenovirus 1 GN=E1B19K (length=636 residues).
atgattaacgatgtgaactttgtctgtttattcaaaggggattacctgggaggtataaagggagcggtggtgaggttggg
gcatttcaccatggatctgcgagtggagttgcagacttttgagagtacccggtgcttgctagagctgtgctccaatcgag
cctcttggtggaaaaggcttttgtttggtacttctctctgccggttagtgaggcaggtgaaggaagagtaccagagcgag
tttgagcatattctctccacctgccaggggctttttgagtctctggagttgggacaccacacggtgtttcaggagaaaat
tgtgaaggctttggatttttcctctccgggcagggcagttgcggccattgcttttgccgcctttattttggatagatgga
acacccagacccagctgtccccggggtacaccctggattacatcagcttgcagctgtggaggttctggctgcgccggcgg
gtttacaactactcgcgggggctgcctccgctcgggcgggcatcttcgccggaggagcagttgccggaggtgaagccgga
ggtggcggggcagggggaggagcaggagcagaagccagcgctgcggtccggcctgggccctccggaggagaattaa
© 1998-2018