Dataset for CDS E1B19K of organism Chimpanzee adenovirus Y25

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G9G841_E1B19K-01 E1B19K gene OS=[Viruses] Chimpanzee adenovirus Y25 GN=E1B19K (length=564 residues).
atggagatttggacgatcttggaagatcttcacaagactagacagctgctagagaacgcctcgaacggagtctctcacct
gtggagattctgcttcggtggcgacctagctaagctagtctatagggccaaacaggattatagcgaacaatttgaggtta
ttttgagagagtgtccgggtctttttgacgctcttaatttgggtcatcagactcactttaaccagaggattgtaagagcc
cttgattttactactcccggcagatccactgcggcagtagccttttttgcttttcttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaaatcccagcgcctgaatgcaa
tctcaggctacttgccggtacagccactagacactctgaagatcctgaatctccaggagagtcccagggcacgccaacgt
cgccggcagcagcagcggcagcaggaggaggatcaagaagagaacccgagagccggcctggaccctccggcggaggagga
gtag
© 1998-2018