Dataset for CDS Unclassified of organism Canine adenovirus serotype 2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|P14265_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Canine adenovirus serotype 2 (length=510 residues).
atggaccctcttaagatttgtgaaaactaccttacttttagagctataattaggggaagtactttgtcgcctggattttt
taggcggtggtgttttcctgccttggctgatgtggtgggcaatatagtggaacaggaggaaggcaggttttggcaaattt
tacctgaaaaccacgctttttggggtcttttgcgcaggggctttactgttgcttcttttactgaaattattacagcagct
cagctggaaaatagaggtagacagttggcctttttagcttttatatcatttttgctacgcaactggccttctgactctgt
agtgcctgaagctgacagacttgacctggtctgtgcgccggcatggagcagaatgcagatatggagccagaccgccaggt
taatcaacgacctccaagattccgtgctcgaggagcaggggtccgcggaagaggaagagtgcgaagaagcgcttttagca
ggggacagcgacgacccattattcgggtag
© 1998-2018