Dataset for CDS Unclassified of organism Canine adenovirus serotype 1

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|Q65942_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Canine adenovirus serotype 1 (length=510 residues).
atggaccctcttaagatctgtgaaaactatttgactttcaggtctataatcaaaggtagcactttttcgccaggcgtgtt
taggcggtggcgcttccatgctttggccgatgttgtcggtaacatagtggaacgggaggaaggcaggttttgggaaattg
ttcctgaaacccacactttgtgggcgctttttcgaggaggcttcaccgttgctccttttactgaaattcttacatcactg
cagcttgaaaacagaggcaggcagttggcttttttagcttttttgtcttttttgcttcgcaactggccttcagactcagt
agtgtctgaggacgctagacttgacttggtctgtgcgccggcatggagcaggattcagatctggagtcaggccgcgcgac
taatcaacgacctcccagagtccgtgttcgaggggcaggggtccgtggtagaggaagagtgcggagaagagcacttagcg
agggacagcgacgatccccttttcgactag
>gnl|bcl2dbcds|Q96678_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Canine adenovirus serotype 1 (length=510 residues).
atggaccctcttaagatctgtgaaaactatttgactttcaggtctataatcaaaggtagcactttttcgccaggcgtgtt
taggcggtggcgcttccatgctttggccgatgttgtcggtaacatagtggaacgggaggaaggcaggttttgggaaattg
ttcctgaaacccacactttgtgggcgctttttcgaggaggcttcaccgttgctccttttactgaaattcttacatcactg
cagcttgaaaacagaggcaggcagttggcttttttagcttttttgtcttttttgcttcgcaactggccttcagactcagt
agtgtctgaggacgctagacttgacttggtctgtgcgccggcatggagcaggattcagatctggagtcaggccgcgcgac
taatcaacgacctcccagagtccgtgttcgaggggcaggggtccgtggtagaggaagagtgcggagaagagcacttagcg
agggacagcgacgatccctttttcgactag
© 1998-2018