Dataset for CDS Unclassified of organism Bottlenose dolphin adenovirus 1

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A0M4LS43_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bottlenose dolphin adenovirus 1 (length=660 residues).
atggacttgaaatttctcgaattgctcgggaaaagagactaccttcgtcggcttttagaaaacgcctcacttcgaacatc
aagcttttacaggtttattttttgtgattctttaactaaattagtttatactgcttgggaacaatatcatcaaaattttg
atgaaattcttccccaggggtcttctttttgggttgttttaaattctggtcgaattggtgcattgcatggtgctctccaa
agtgtagatttttctagcaacggtaggggtattgctagtttggcatttttagttaacattttaaatcatttggacgcttc
tggtgcttatagcaaaggttttactagtgaaatcttatcacttttagtatggccgaaaataaggtttgtgctgaattaca
agaaaatagcagcgctagaagcagaagtgtacccatctatgtcaacttcccgtttgcctccaataacgcgaatggttcca
atgaacagaatcagggaccaggagcaagaggcgaatgtggaacaaccagaagacgaagttccagcacagaatctattcaa
tcctcgaactcctcctctgagcagcagcagcagccagagcagtcagaacagcctagacagcgagtcggaatcagacgagg
ggtggttggcaatggattag
>gnl|bcl2dbcds|A0A1X7MN46_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bottlenose dolphin adenovirus 1 (length=552 residues).
atggacttgaaatttttgcttgctttagataataagaagtatcttgaaaagcttttagttttagcttctaaaagaacttc
tttcttatatagaacgttttttgctgatgatttaattaagctagttcatagcgctagtaatgattataaaagtaactttg
aagatgttttacccgctggttgttctttttggattttgttaggttctggaaaaattggtactcttcaaggcctgcttcat
agcgtggatttttctagtaacggaagaggtgttgctagtttagctttttttgtccatattttaaattgtttggacgaatt
tctttttttttctaaaacttttaatttggaggttttagtgaatacattatggccaaccatccattgcgccttgaaccagc
agcgggtgaacgtgttgcaaggggcaatgaaccagctgacggagacgccggtcccctcgatcgagtcattaatctcccca
gagagctcgggctcggagaacgagtcagatccagtagcggaattagaagagggctccttggagacggaatag
© 1998-2018