Dataset for CDS Unclassified of organism Bat mastadenovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1J0FAP3_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=546 residues).
atggatcttttctctatgtgcgccgattatagctcttttagatatattttaaggggtagtctctgtggcagtagttgggt
tagaaagtggtgttttcctgctttagcagatgctattactggcattgcagatgattacgaggatggatactggagagctt
ttccgccagatgatattaactggaacctcctgagaagaggttacacttttgcagcttttacagatttgtttagcagtgtg
gacctaggcaatgctgggaggtttatgtcttttctggggtttttaaacttcattttgcgtaactggccttctgattctgt
agtgctttctgcagatagacttgacttaatctgtgttccagcatggacgaagatcatgctatggagccaaactatgaggc
agatggaagagctgcagctgttggaaatggcggccgcgcaggcagcggcggcggccagaggggctcgggcagaagagacc
agcgagaccaccccgctgctgcagtcaaccagcacccaaacggagcagctggaaacggacttgtag
© 1998-2018