Dataset for CDS Unclassified of organism Bat mastadenovirus WIV17

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1X9RIQ7_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV17 (length=507 residues).
atggagagggctgcagacatccctttttcttttcagggattaaagcatattttgactttgacttataaagcttctaagtc
ttcttggttttggagaaaattttgtactccttctttaattcttgctattcttgaggctaaggaatcttatgctgaggact
ttgattcttttttaactactgatttttgcttacaaagttttttagatacattagattggcagtctttagaaaaatcttta
attcccaatttggatttttcttcttcggggagagctattgctagtttggcttttttatctagtattatagaccgcttgga
attttctactatttttacatcttcatatttaattgaaaattttgcttttgctgtgtggagatgggcgataacattgacga
agggatcgaagacatcggagcagttgaaaatgtcgaaaatgaagacccccgagctaacggagaagcaggaggaggcgctg
acggagctaatgaagagttgggattaa
© 1998-2018