Dataset for CDS Unclassified of organism Bat mastadenovirus WIV12

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1B0UI04_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus WIV12 (length=417 residues).
atgaagaagacctataaggacgttcttcgttcttacaatactgtccgagacattttagccggggcctcggataaaacttg
gtttttttatcgcaagcttttttgccacagatgggtctattcagtgcatcgaattaaaatagattataagaaagattttt
ttaatattttggagctgtggcctcagattttgcaatttttagagattggaaatacttattattttgagaaaattgtagtg
ccggagttaatttttgatacttttgaaagaacaattgtttctttagcttttgtggcttttttaattgatcggtggaagga
gcaaggaattttttcttgggattatattatcgaaacagccgctttgcaagtatggcaggccttcatgaggatgttgtgga
gagagaatctgttatga
© 1998-2018