Dataset for CDS Unclassified of organism Bat adenovirus TJM

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|D3X7A9_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat adenovirus TJM (length=549 residues).
atggatccactcgctctgtgtgccgactatagcacatttcgctttattattaggggcagcttgtgtggctctgggtgggt
gcgacgattctgttttccagctttggcaaatgtgttggctgaggtagcagaggaatatgaggaggggtactggagagctt
tcccccctgaggactacaactgggacttgcttagacggggttacacttttgccgcttttgtagatttgtttagcacagtg
gatttgagcaacggaggcagggtgctttcctttctagggtttttatcttttatcttacggtattggccttctgattctgt
agttcctgcggcggatagacttgatttcatttgtatcccagcatggacgaagatgcagctatggagccagtccttgaggt
tcatggaagagctggagagcgcgatggccgcccggcgggaaggcatggggtccgatcccgctcccgcccccgccgaagaa
cctactcagccagtcaggctcagggccatcacgcggagcacgcagacggacctagaccaccaggattag
© 1998-2018