Dataset for CDS Unclassified of organism Bat adenovirus 2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1FQL6_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat adenovirus 2 (length=543 residues).
atggatctcttgcgcgcttgcagtacttactctgcttttaaatatatgatgaaggggagcacttataactctgggtgggt
taggagatggtgttttccggggctttcagaggtggtcgggactttggctgagactcactcttatagattctggaacatga
tgcccaggcggcatttgtattgggatttagttaggcgtgggtattgtacttctttttttgaaataatgtttcgcaaggca
gatttgagcaaccgggggcgcgtattagcctacttggcctttgtgtctttcttgctgagaaactggcctcaggactctgt
tgttcctgaagcggatagacttgatttaatttgtattccagcatggaccagaatgcagtcttggcagcaaacggtgaccc
taatgcaggaaatagaggagatccagcaaggcaccggggcagaggaatgtacagacgccgagcaggccttcgtggaggag
gaggaggagcagggcggagggagcagtcccgacccccttacggagggctcgatgcagccctag
© 1998-2018