Dataset for CDS Unclassified of organism all

[Download (right click)]

156 sequence(s)

>gnl|bcl2dbcds|B7SB93_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Acropora millepora (length=561 residues).
atggtacacaacaacgaccgtttgaggtctttcaataccattgtcaaagactatgtaggatacaaacttcgtcaaaaaaa
tatatttctggatgggtataatgtgaacgagagtccttcggcagcagcgtgtcatttgcggcgagtggcggacgaactca
tagaagagaatagacagttgttcgactccatgtgtgatcaacttcatcttacacacgcttctacttatgccacatttgtc
ggaattgcggacgaaatttttcagacagggaaaaactggggtcgcattgttgcttttctggcttttggagccacgttggc
tgtgtattgtgttcaaaaagaggatctcgcagaacttcttgacaacattattgaatggctctctttgtatatggagcaaa
atcttggccaatggattaacgagaatggcggatgggaagggtttattcagttcttcaaaaaagaggatggctctccagga
aatggacgaaatggaggatggcgcattgctgctgttgcaggacttgggattggtgctcttctgatgctagcttgtagata
a
>gnl|bcl2dbcds|B7SB94_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Acropora millepora (length=636 residues).
atggccggagcaacagctgcgctgaacaacgaagatctttccccaacactgagcacctcggaattgtcaagatacgacaa
ggatatcgtcaacgatggttactcactaactgtggactatgtttcttaccgactaaggaacaaattcgaacaaaacaaac
tcagtggattaccgcgaaaattccttattcctcaatcacctataagcgcatcatcgagtaatctacgaaaactggcgact
cttatggaggctgaacaccccgacttgttcgaatcattgtgtacaacgctaggaataacaccaaatacagcgcatcctac
gtttgtcggtgttgcacaagaaatctttcaagccggaatcaactggggcagaatagtggcccttttcacgttcggaggtg
tagtggctcatcacttcgtggaaattcagcgactagaaatggtgcaacgcatcgtggaatggatcgctgactttattgaa
cataacttgctgacatggatcagagagaatggtggctgggatggatttgttgctcacttttccgactcctcgcagtctca
attcacatggaagagcttagtcactgttggaagtatttgtgcagcgggtcttactcttctggcattaaacaagtga
>gnl|bcl2dbcds|A0A1X7U9C1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Amphimedon queenslandica (length=690 residues).
atggcggtagcactacaacctcgacatgtgacagctacttctccagtcccagaagaacgtaggaagaaagacaccacgtg
gacaccatcatcaactcaagcctccaatattctagctaatactgatttcgcctaccagacgaaagaaataatacacgaga
ccttttacggtctcctattggagcaaggactcaagctaaacggtgggcatgtggagcccatattcacttcagaaacgaac
aggaaggtttatagcagtctaatgggcgcctgtaagcaatttctaagactacacagtgaccagattaggagagacatgga
acagctagatatatctgaaactgccttgtgcgtcacatttcacagcaccatgcattcaatgttttccgattgcataaact
ggggtaggatcgtagcccttatatcctttgctgtccttgttgcttacaaggcccacaagacatcacgtcatgttgtagag
agcatagagggttggctaataaccttcatatgtcagaacttgagtcaattcatcatgaaacagaaaggctgggcaagtgt
accagacagattcagctcgaataaaattggaggagatatagttgacgctaaaaatggcggaggttcgtggctagcactag
cagcagtcggagtaggagctgcccttgttacagccttcttgtctaaataa
>gnl|bcl2dbcds|A0A1X7UKJ6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Amphimedon queenslandica (length=705 residues).
atggcggtagcactacaacctagacatttgacaagtacttcgccagtgcccgaacgtaggaagaaagacgccaaatggac
accatcatcgacccaaggagcccatgcctccaatattctagccaatactgatttcgtccaccagacgaaggaaataatac
acgaggtcttttacgccctcctattggagcaaggcgtcaagctaaatggatatacaacagggcatgtggagcccatattc
agttcagaaacgaacaggaaagtttataacagtctaatgggcgcctgtagacaatttctaagactacacagtgaccagat
taggagagacgtggaaaagctcgatatatccgaaacaacattgtgcattacatttcacagcaccatgcattcaatctttt
ccgattgcgtaaactggggtagaattatagccctcatatcttttgctgtcctcgttgcttacaaggcccacaagacatca
cgtcacgtcgtagagagcatagagggttggctaataaccttcatatgccagaacttgagtcaattcatcatgaaacagaa
aggctgggccagtgtaccagacagattcagctcagataaaattggaggagatacagttgatgctaaaaatggcggaggtt
cgtggctagcactagcagcagtcggagtaggagctgcccttgtcacagccttcttgtctagataa
>gnl|bcl2dbcds|A0A1X7UUJ1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Amphimedon queenslandica (length=645 residues).
atggcgctagtggtcaatcctgctccagtacagcaccagtatcaccacaagaactctcccaagagacgggggtctcctgt
acaagatgataagttctacgaggagactcgaaatctcatcactgcatgcatcgagtccgcttctggcaaggagcccctga
gcgttaaactgagcgaagaagcactgaggatagtcggtatggtacagcaaactctaaaagctgatgagatcttctttcgc
aagctatgcgaagagcttgagctgacggcaactaatctctttagcaagctaatggacgtctggggtggtatgttctcgga
tggtcaggtcaacatagggcgtcttctggcattgctagctttctgtcagtgtgtaactgtgtactgtaggtctgtagggc
tcccttcaatagagtcaagtgtgccccattgggcaagtattttcatatcaacaacacacctcaaggattggattactaat
agaggaggatgggatgcaatatcaaaagaactaatgttacgcacatctgccacaaacagtagtactagtagtagaacagc
aagcaacgggggttggttacaatggggagtgagtgggattgcacttgcaatctctgtattcgatgcactgcacaattcat
cgtag
>gnl|bcl2dbcds|A0A1X7V1Y6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amphimedon queenslandica (length=690 residues).
atggaagttttgagtccttcagtaacaagacaaaaaggagtacatcatcataatttggcaatggcttctacctcctcctc
tattcccagtgactccagaattggacgcgttgtcaaacgcacagtgaggtctctactggagaaagatggatacagacaag
agcaagctctctctctcattgaccctgttggtcagtttggggaagacgagctgttactggtagagagaattgtgaatctg
gtcctaagactagtggatgacccgaggcagtccaggaggataacagtggctgacctggagcaaaatgactggcccctaca
accagacaatgttcattcagaattcaagacagttgcaacacaaatattctcagatgatattaactggggacgcatcgttt
ctttcctcagcttctcatccacttatattttattctccatgagacgaggcatgcctgaatcgatagtacagagtgtgtgt
gggtggaccacgagcttcatggagagagagctaaggtcatggttccaatcgcattcatgggaagaattcctgtcatatgg
agaaagtatattgaaggcaagacaaagaaatggtgaatcagaaagaccgatttggcaaaatttagctacaattggagcaa
taggaataggagctgcagtattgttctcattacggagttcattctcttaa
>gnl|bcl2dbcds|A0A1X7VN87_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Amphimedon queenslandica (length=726 residues).
atgaatatcattactcgagctctctataaaaagaagcaaattagacaagatctacacttaaaagctaaaaaaccttcaag
caaggaaaagaagaatcaaaagccaatcatgagctcagttatatcacagcaagaggaaaagcagtccacatcatctgcag
gaggagtcaaagcactcactcaatcatacatcattgaacaactcagacagaatggttacaagtcactagctgcaagtctc
tcaaaagaccagcttaccatatcagaagaaatgcacaaaatagtcaagagaataagcaatcagctagcacaagagaagaa
agagcagatggaagacatttgctttgagctccagctgaccaaggagacactcaccgagaccttcaacggaatctctcaag
aactattcaaagacgggataaaatggggcagaatagtaaccttcatagcattcagtggagcaatggctgtctactgtgct
caaaattcactcggtgatcaagtgagcgatgtaatcagacagactggatccttcatacaggacaacctacaccaatggat
actcaataatgatggatggtgcggattcgttagacatttcgacgagcaagatatcaatcttaacttttttgtaccggcat
tcttcatagggctaggaatgacagcactagcagtggctggcagttttctcgcatttaaaaggaaatacactggaggtcta
ttatga
>gnl|bcl2dbcds|A0A087ZQJ8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Apis mellifera (length=903 residues).
atggccggcgacgacgatgcatcgccgaacaatgagatcctcagtacagacggagaggggcagggtgcgtcagtgcgggg
ggaaccgcattccagagtgggcggcatcctggaatgcgatccccccggtaacaagaattcgccgagcgagcgagtctgta
acaacgacgactgcgccgacggaagcggtgaaactatgattgccgacgactgtaacaacagcggaggcgttgaaaccgtg
attgccggcgataacggcgctttatgccgatatgctctcagcactgtcaataccgctatgtcctttatcgaagtttgtca
gattcgactgcaacatcttttcccgcaattgatttcatcttcacgatacagactttgtgaagattccatagagcttacgg
cagaatgtttggcgaatgatgtaatacggtacctacttaaggaagatatttatcttatatctcgagatccagtttcccgt
agtatgagacacaatgtatatcaaatgttgaacaagcatagtattctattcgcgagtatggtaaatcgtttgaatgttgt
accggatacggcgtacgaggcattcatgggagttgcggatgagctgtttttacatggtggagttacatgggcaagaatcg
tttgtctatatgcatttatgggtagactcgctctttgggctcgggatagacgaatgcacgctttaaagaaaaaattacca
ctatatgtctccagatttattggtgaaaaggttgcacattttatcaaaggatatggaggatgggagcaactgtgtataga
atatcctgtggcagaagaaataagtggagcaatttggagaagtcttataatgacaggtgctacacttggtttggttgcaa
ctattttaacagtgacctcctga
>gnl|bcl2dbcds|A0A068QLP8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Viruses] Armadillidium vulgare iridescent virus (length=462 residues).
atggacgaaataccaaagataaccaaatgtgttgtaaacccttctttaattaccgacaaagaagggttaagaaaggatct
cgctgttgcagttttatatcttatcaaagaagtgttgaaattttcaaacaagaaagatgtaaatggagcagacaaattat
gccaagatcttttagcccaaaccccaaatgttaattttgaaacctctgtttaccaggtatttgaggaactgttcgcggaa
gggatttcgtggtataagattgcaactctctttgccttctgtcacattcttgccaccaaaaccacagtttcgttagttga
aagttcattacgaagctatatttctgattacctttttaaatgggtaagtgaaaacggtggatggaacggcttaatcattc
tagcaaataaatgcagcaataattattgcattgcgccggaccaaaataatgagggcaattag
>gnl|bcl2dbcds|A0A3B1J8Y8_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus (length=624 residues).
aaagaggagaagctgccccggacggagcggccggaccgcggcctggagggactgcagtccgctaaaggagcctccatggg
cggcgggtctctgcccgactccccgcgggcggacgaagacttcatcccggactttagctgccgctgcccgggcttttacc
gcgggtacctgggccagaagccccgggagcagagcccggccctacggaccatgagccgggtggtggcgggggtcgtcttc
aaacacgggatcgcctacaacggtatggtccagaagctgaatttggaggagcaggacgacagtatggactttattagcag
cgtagctaagactctgtttagcgacggaaaccacgaactgcggatcttaagcctggtggcgtcggtgtgtgttgacatgc
tgaagaaggaagagtcgagatcactgcaccacttgtatcactttgcatcacttatatcacttatatttgtgtgtgtgtgt
gtgtataatgtgtgtgtttttgtgttgcaggagggatttgtggagttctctgaagtgaaaggtcagaatctgctggttaa
atctctgaaggctgtatcaagagttgcagggctggggttcagtatgttcctgctgcactggtaa
>gnl|bcl2dbcds|A0A3B1JPB0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astyanax mexicanus (length=657 residues).
atggccaatgaaagtccgtacgacagccgggacatcgtggagaaatatctctaccacaaacttctcaagcgcggctacgt
atgggagttccgcccggcctccgccgctgcctccgccaccgccgccgccgccaactccacctccgcagcctcagcggacg
acgacaacgacgacgaggccgagcctgagcgcgccgggcccgcgaggctgcaccggctcctgcgcgaggcaggcgacgag
ctcgagcgcgtctaccagcgggacttcgccgccatgtgggaccagctgcgcgtgggacccagcgcgcagctccagcgcag
ctttgtggccgtggcggaggagctgttcggggacggggtgaactggggccgcgtcgtggccttcttcgagttcggcggca
cgctgtgcgtggagagcgtgaaccgcgagatggcgtcgcaggtggagcacatcgcgcggtggatgaccgactacctgaac
gggccgctgctgcagagctggatccaggacaacgggggctgggatggctttgtggaaatctacagtcagcagagaaggtc
cattttccatccctggccctatctaaagacagtgtttggtctggcagctctgggggcggcaggagtaaccatcggagctc
tcttcactcagaagtga
>gnl|bcl2dbcds|W5K2Q2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astyanax mexicanus (length=606 residues).
atggccagcaaaaacgacatggtggtgtacgacagccgcggcatagtggagaactatctgcaccacaagctggccaagag
cggtcacgcaagaggagaagaagaagaggaggatgaagaagaagaggggaaaagggtgcatccagctccaccggccgtgc
acggagctctgcgcgaggctggagacgagctggagcggctgtaccgctcggatctgaccgacatgaccgggcggctcgag
ctggagcccgcgggcgcgcgccggagcttcgcggcggtggcggacgagctgttccgggacggggtgaactgggggcggat
cgtggcgttcctggagttcggcgcggccgtgtgcgtggagcggaagcggaccgccgccgagggcatcaccgcggacgtgg
ctcgctggatgaccgagtacctgaacggaccggtgctgagggggtggatacgggagaacggaggatgggatgccttcgtg
gatctgtacggccggcagaaggactcagtattcggcagctcttggccgtctatagtgacggtgttcagcctggcggcact
gggggccgtgggcttcactataggagcgtacctcgctcagaaatga
>gnl|bcl2dbcds|A0A158N8X4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Atta cephalotes (length=969 residues).
atgagatgtgagaacggcgcatcaccgaggaaacttgagaagacgttggaaaacggaagcgatctcgacggaggcgagga
atggcgcttagtgggtatggttccttgctccagtccggtacgcgagaagaggatggccggcgacgacgggacgacgacga
acaatgagatcctcggcgcggagggtggggaggaggagcagggtacgtcagcgcgaggggaactgcattccagagtgggc
ggcattctggaatgcgatccccccggtaacaggaattcgtcgaacgagcgacccgccgccaccgctgctgctaacaacga
ggacggtgtctgccgatatgcggtcggcgctgctaaccgcgctatgtctttcttcgagatgtgccagattcgactacaat
atttgttcccgcaactgagtccacctccacgttacaatatccacgatgattccatagaatcgactgcggaaatcttggcc
aatgatgtgatgcgatacttattaaaggaggacatctatcttatatcccaggatccagtctcccgcagtatgagacacaa
tgtatatcaaatgctcaacaaacacagcattctctttacgagtatggtaaatcgtttaaacgtcgtcccggataccgctt
atgaaacattcatgggggtcgccaacgagctgttcttacacggcgttatcacatgggccagaattgtctgtttatatgct
tttatgggcagattggctttatgggctagggacagaagaatgcacagtcttaaaaagaaattgcctttatacgtctctag
atatgttggtgaaaatataacacactttatcaaaggctatggtggatgggaacaattatgtgttgagtatcctgtagccg
aagaagttagtggagcagtttggcggagtctactaatgacaggagctactcttggtttgatcgccacgatcttgtcagtg
acttcctga
>gnl|bcl2dbcds|A0A0C4XXZ0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Azumapecten farreri (length=678 residues).
atggctacggaaggaattcaaatggggtcgaactaccctgttaaaggaaatttgttcgctgaaattcataaacagctggg
gcttatgccaggctttcagggactgggacaggatatgagtaagttagatcaacaaacacagacacctggtagtgcttctc
ccctggaaaagataagacacgaatctgaggttattgcggctgatgttatcagcagttttggacttgaagagtgtaagaaa
cctgtggacagatattgcaaaacaatgcgtagaactgttcgtgaactatcagaccgacatgacattgcattcaaaggaat
ggtaaacaagctaaatgtggacgattcaaatgcttttccaacatttgtgtctgtggtagatgaaatttttgaggatggac
aaattaactggggtagaattgttgctgtttacacatttgcatctcggttagcattgcattgtcgcgtaaacactccagat
tgtgatgaaaaaatagctttgtatgctgggaaatatgttgcaagcaaactagggcgatggattcttgataatggaggatg
ggatgcgtttgccgattatttccctgaacagggtgcaatggaagacaaactttggaagggattggtctatactgccatgg
gtcttggagctttagcgaccatggttgctacaaggtga
>gnl|bcl2dbcds|A1L569_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Bos taurus (length=729 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
cagacccaagtcctggccccagccccggccccagccccaggcatggcatcaaccctggcccaggccctagccccaggcct
ggctcaggctgtgaccccgcctgcccccaggaccaaccagaccggggaagggacactgacagaggccctgctgcagctgc
agtttgataccgatgaagacctgggggctctgcttggcaacaacactgaccctgccgtgttcacagacctggcatctgtc
gacaactctgagtttcagcagttgctgaaccagggtgtacccatgggcccccacacagctgagcccatgctgatggagta
ccctgaggctataactcgcctggtgacagggtcccaaaggccccctgacccagctcccactcccctggggccccctgggc
tcaccaatggcctcctctcgggggatgaagacttctcctccatcgcggatgtggacttctcagcccttctgagtcagatc
agctcctaa
>gnl|bcl2dbcds|Q05KI9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bos taurus (length=513 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctacggga
acaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggctggtgtg
gttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|J9PBM3_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Canis lupus familiaris (length=126 residues).
ggggaccccccggagccgggcgagtgggaggccagggtcggccaggcccgccggcacctggtggccctcctctgccgccg
gctcacaggccagcaccgcgcctggctggaggcgcacgacggctgg
>gnl|bcl2dbcds|A0A2D3E532_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Chondrosia reniformis (length=675 residues).
atggctaatgtatcaggagagctaccgagctctggtcaagctccaaaattaacgttgaatgacacctccaacttatcagc
tttaatagtagtcacctttctgaaggatattctggaagaacattattacgagggactcgtgaaaggcattacagaccaaa
aaagatttagagagttaacagaaagagagaatatcaggaatatggtacaaaaggtaactggtaagctgaaagcgattatg
gccaagtttccagaatctaacgtcactagcgtaagacagcgatgcagtagattggatattcaccaagccaatgcatcggc
aaagtaccacgtaacggcgcaacatttatttcacgatggaataacctggggtcgactagccttgttttattcttttaccg
ccagcttctgtgtttatgtggcagaaagtcagatggaggacttagtagacagtacgatagagtggtgtctggcgctacag
cacagccgactggatccctggatattacagtcccacggatgggatggttttgttgagtatgcagacaaagctttgggaga
gaaacctcgggtgaatgaagacgatgagacacacttccatttcagtggaaaactagtagctgctgcagcagttataggtg
ctgcagctctagctagcttttttggaagcagataa
>gnl|bcl2dbcds|A0A2K5HYN7_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Colobus angolensis palliatus (length=213 residues).
atggcacgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaaattacaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaactg
gcttaatttttctgactcttaagaaaacgattgccaacacatactttactttt
>gnl|bcl2dbcds|K1PS96_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=2400 residues).
atgcccccaccttcagagcaagaaatcaaagctgaagttcgtaaaatcttggaacaattcctaaagaaacaactgctgaa
caataatgaagaggaaagtgcaatacccactggatttcagagagtatctgtggaggacgtggttgaaacagatgggccag
gtagcacaagcacatctcgtgaaggatccaggtactcttccaaaaccagctgtgccagatgccgtagcgaggccagccag
tctattcccacaagttctattcgatctctcactgacaatacaattgatttccctttcattgatgaggatgaaaatgaggt
tgatcattctgataaagaccactcagaaaggtctaagagtctaccctcaaatattctatcgtctgtcaaaattcaggata
aaaactctcttgcattatcaaaatcacttagtccaaccaaactcagggaagtcatcaacaatggccctcctctaaataaa
gcatctgaaaaaggagaccgagaacttagtctatatagcagtgaagattttctgcagacagggtctgggctcaaggacat
agaggagataggtatatcaagagggcgacagagactgaagtctggaacagaatctgggacagatgatactgactacgagg
aagaagtcatctccccaaatcgaaagaagaaatctatctttacacgactgaaggaacgtatgaacaggagtttgagtcgt
ggtcgaatcaaagaaaatgaagaaaataaaagaacaaggtcccggtcagaaggttcagtaataataaaaagacggaaacc
tagaaaaaagaaagacattggttccagtgtggataaggtgagtgatgttgttcaaaatgttcacacccacaaacatggcc
acgttgaacaacatcactacagcaatggaaataaatcgggaatgttgatggagagtgaagtgtgggagtccacagatgtg
actggagaatctgaacacaagcatgaagagaggcattccaacatcagggagagtaaggaacagccgtccgatggtgagaa
tggaatcatgagacggctgaagaaaatgacctccttcaagaagtccaagaaaaataaatctgattccccatcctcgaaag
catcaaaatcagacgaggttgattttgaccacaagaggccaaagtcccccaaaacagactttggtcgttctgtgtcttct
ggtcaggggtaccaagaaagggtacatatgaatggagaccactccagacaaaccaccactaccactgtggtaacggggac
acaaatacaaggttgtaccgatgagaaccttccagagggccccattaaaggagaagtgatggatcttgccaagaagaaca
aatcgttcgtgctggactttgagacttgtgagaggcagcaaaggagactccttcctgatggaagctttgacacgaccgtc
caacaacatgtcaaggtcaaacactttgatgaaggtcatgatattgaagttgatggcactgaagaccaagcaatgtgtcc
aagacatgcagcatcaggacagcctaaccctgaaaaagaccgcctgtacactgcagttgcagagaagttggcacacattg
gggaccactatatggctaccagtccactgtctgatagtaccagtagctccgtggatcacactgcgactaggagagtcagt
gccagaaccccaaacctacctggagtggatgaaagagacagtgacggattgacacagctagaaagacagctaagagacaa
gtttagagaagtgggggatacattttctcttgacatttctcccgattctgtgaaagatgctgccatggaaattgccaagc
aggcaacctaccagaagttccaggaagtggtcgacaacaagatcggccccggcaacagctgggaccagattgccgccgtg
ttctacctgaccaagaaagctgtcactcttgcaggggtgggcggggccgttgcactgcaggtgaaagatcttgcggcaga
atacgtggccgataagtttgccacatggattgtggatcagggaggatggggtaagcacttgtcagtcttggcgcctccag
aacttaacgagaacattaccgtcaagatcaacttctccaagtgctacaacgtacggggaacacaacagattcttcatatg
gagcaaggtcccagaagtaaaatcctggaagtgtttaggataaacacctatagcaactccccagggactaaccgaaactg
tctctggatgggagggggtttcactatagacaatcacactaccgttaccttctcatccagtcgaggacggccaattcctg
attctgtatgtcgaagtacatccttcaccgactttccagacgaatatctccatatacgattacaagaactgtcaaggtga
>gnl|bcl2dbcds|K1PWI6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=441 residues).
atggaccgtttgggaacgagatatattgtgactgactacttgaaccatcgtctgtcgaagaatgggcacacatggactca
ctgcccgcccctcctggatccccccctcaagatccacaccacaatgcgggacaagggggacgaattcgaggaactataca
aggtccagttccaggacttggtggaccagctgcacgtgacccacgatacgtgttatcccatgtttaaggcggtggttgag
gaactgttccaagggggcacgaattggggtcgggtggtggcgctgttcgcgttcagtggctccctggccacgcgctgtgt
ggagaaagggatggcgggactagtggactctatcgtggactgggtgacacagttcatagaacaggacctacgtcagtgga
tagaccagcacgggggatgggtaggttatcatcgtgaatag
>gnl|bcl2dbcds|K1QHH5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaaatagaaaacataaagcattccagtggaaactatctgaaaggaaatctattcagtgaaattaaccggca
gcttggtattcttcctggatttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacggcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaaaggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|K1R9D6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=618 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcagtgaaattaaccggca
gcttggtattcttcctggatttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagttcgacagacggctgaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgatcgacataatttcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacatttgtatcagtagcggatgagatttttgagg
acgggacaattaattggggtagaatcgttgctgtctacactttcgcttcacgattggcagccgattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggttagtattgatttgaatgtcaactgtaacttgaagagatcattagtataa
>gnl|bcl2dbcds|B2L8N7_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio (length=693 residues).
atggctttgagtttggattttaggcgatgggccgctggaagccgcttccagcggagcgcagcaggaatctggctcctaac
ctcatgctggtgcgtgcttcagcgtctgaggacgtgtgctctggtcgcgctgtgctggccgaggcccgggacgaacggct
tgaaagggctgcagctggacgggttggttcgtgtccgcggtgggactggctctctaccggccaccccaccttattgggag
tttcccctgtccatgccagctcgcgatgttgagcagccagtactgctgttcagagatcagatagcgggaatgtgtccggt
agaccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcataca
aaggaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgttt
aaagatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagct
ccagcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctctgttgtccgtcatggtcttttgg
cgctggtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|F8W266_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio (length=630 residues).
atggcacaggagaatgtgtataataaccgcagtatagtggaaaattacatccaccataagctgtggaagaagggatacgt
ttgggaagtgaatggacatgacagtgtctcgaatggactgagtatggggaggcaggagaacagcgtcgtctctcccagct
cccgtcacgacccatacagcgctcttcataacgtgctacgggaggctggggatgaactggagagtttatatcagtcggac
tttgcggagatgtccaaacagttgcacgtcacgtccatcacggcacatcagcgcttcaacgcagtcatagatgagctgtt
cagggacggcgtgaactggggcagaataatcgcttttttcgagtttgggggcaccgtttgtgctgaatgcgtgaataagg
agatgacggggcaggtggataacattgctgtctggatggcagactacctgaacgggccgcttcacggttggatccgggag
aacggcggttgggaagcatttgtggagctctacagcagccagagggattctgtgtttcacagttcatggtcatcaatagt
aacggtctttggtctagctgctctcggggctgttggcttgaccataggagcctaccttgctcaacaataa
>gnl|bcl2dbcds|A0A0P5E6Z1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Daphnia magna (length=582 residues).
atgaagaaaaccatggcttctaccacttggctaacaagtaataacactacacagccgacccgtgaattcgtgttcgaaca
aaactcaactttcgccatcaacattgtcaaagaagcattaggcgagaaggtagatttgtcaaaagataaaatctacagga
cgttatcaacatgcgttggagaagtgttggcaaattgtgaatctcctatgcagcagttagtaaatagactagacctttct
cgtggtataggccatgacaagtttgctacattggctgatgaactgtttgaagctgaaaatggctttattgttctatggga
gaggattgtgactttgtttgccttcacatgggtacttagtaagcagctacatacagaccctgttgtgtcatccagcaata
tcagcaagatacttgccagctacttaaatgacaaaattactccatggatcttgcaagaaggaggctggattaaaatctgt
aacgaatttggagatgatgcagctgcctccaacaagtggaagtacttctttttaacagggcttggtattggtctggtcgc
aacatataaattgacacattaa
>gnl|bcl2dbcds|E9FUS6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Daphnia pulex (length=570 residues).
atggcttctaccaattggctaacaagcaaaaacacttcacagtcgactcgtgaatccgtgctcgaacaaaactcaacttt
cgccatcaacattgtcaaagaagcattaggcgagaaaattgatttgtcaaaagatacaatttacaggacgttatcgacat
gtgttggagaagtgttggcaaattgtgaatccccaatgcaacagctagtaaatcgactagacctttctcgtggtgttggc
catgacaagtttgcttcactggctgatgagctttttgaagctgaaaatggatacaacattctctgggagaggattgtgac
cctattcgcttttacatgggtactaagcaaacagctacattctgaccagatcgagtcatctaataatctcagcaagatac
tagcaagctacctcaatgacaaaattacaccatggatcttgcagcagggaggctggataaaaatctgcagtgaatttggt
gaagacacatctgcgtcaaacaagtggaagtacttctttttaacaggactaggcattggtctggttgccacctataaatt
gacacattaa
>gnl|bcl2dbcds|A0A0M4MPT9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Viruses] Felis catus gammaherpesvirus 1 (length=570 residues).
atggagcaaaatcaggacgaacatgcagatgtactcgcagccttcattggtgaattttatgggttttatggactgccgtt
ttcgggtgattttggatcaactgagtgtcatgtagttggactggttttggctgatgttgcgtatcaggcaactacacaat
tacaaggatttgaacacctgtttcagcaaatgctgcaaatggatcttgatgaggctgtgattttgttccaggaagttgct
caagaactgtttacggaaatcaattgtggaagaatcataatttttttaagtttttctggacttttacttgttaaatgtgt
aacacagagaaaaattttattggaaagatgtttgcatacgtccattcttacactccttcgaggtgttctgggtaactggt
tagagcaaaatggggggtatgatgcacttttaaataaccttgtacaaaatcacccccttgtagatctcaccacgtctcca
tcgtatagatttttgacgtatttctttatatttctgtgtggtgccgctgtcgctgccctattttctattttattgatgaa
aataaggtaa
>gnl|bcl2dbcds|G3PJ83_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gasterosteus aculeatus (length=546 residues).
atgtcgaacgagtgcaaccgccacattgtggaaaagtacatctgccataaactctccaaacgaggctacgcgttcggatt
cgatgacgtcggggaggaagacgcagccagcaacggctcgatggttgtcccgccgccgaccgcggtccgccggtgccgcg
aagccgggcccgacggcgagagcttcccgcgcctctgcaaacggctgccgcagtccgacccgaccgccgccgccacgcac
cgggtcctgcgcgaggctggagacgaactcgagcggctgtaccagccggacttcacggagatgtcgcggcagctgtacct
cacctccaccacggcgcagaggcggttcgccgaggtgatagacgagctgttccgggacggggtgaactggggccgcatca
tcgctttcttcgagttcggcgggacggtgtgcgcggagtgcgtggccaaggaggagatggcgtcgcaggtggacaacatc
gcggagtggatgacggagtatttgaatggacctctgaacatctggatacaagataacgggggatgg
>gnl|bcl2dbcds|G3PW08_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Gasterosteus aculeatus (length=603 residues).
cagtctgatatcgctgggaggaaaatgtcctgcgggctgtggaaagagaccttggctctggcagaggactacctgtacct
gtgctgcagcagcccacggccggcccctccacctcccagcgggtcagccgctgccatgaggctcctggcctgggacatgg
agacccagcaccaggcccgcttccacgccctcgcccagaccttcctcaggcagtgcgggccggacccctgctccagcctc
cggcaggtgatggaggagctggtgggggacggacacttgaactgggggagggttgtttcccttttcgcttttaccggggt
gctggccaggcagctcctggagcagaaggccacgaagctggggctggaccctgggcaggaactaggacaggagcccggaa
gctgcaggggactggcggagaccatagccgactacctgggagaggagaagaaggactggctgctggagaatgacggatgg
gaggggttctgcaagttctcccgcagcgccagagaagtcggccacgactcgtccatgaagaaagcgctgtttgctgctgc
tggcgtgggcctcgccggcctcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|Q967D2_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Geodia cydonium (length=708 residues).
atggcagctcggggatcggcggccccaggaggacgggccaacggcagattccactctcgtctttatctccaaaacacggc
cgtgatggaggagctctacagaaggaacctctccgaggatctagttcgagacaacggcctctcctgtggaggccgggagt
actggagggagccggcgagcacggttggggctgccagcgacggcctgagcgaggaggagaggcggacggcggcggatgcg
gccgagaggatgacggcagtgatagctggaacccccgggatagcggtggagagaaatgtcagagatttcaggcgcggcgg
ttgggacgtgacccctgacaatgtagagtcggagtttagggaagtggagagacggacgttctcagacggcgttcactggg
gtcgggtgatagcgttcctcgccttctccatgtcattcgctgcgtatgtcaacagtcgcgggatagacggtggagcctac
agtgtcttcaactggacgctgagggtgctgaatgacagccttgctgacttcatccagagagagaatggatggagaggatt
cattgtctacgcagacacactcctaagagcgcagggctctacacctccgcagcaccagacaagaggagtgtgggatgcag
tagccggtattggtgtcattggtgttgggactcttctggctcttggaatgagacaagctttttcatga
>gnl|bcl2dbcds|G3R922_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla (length=240 residues).
atggcgcgatctcggctcactgcaacctcagtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaactggcctaatttttctgactcttatgaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|T1EKX5_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Helobdella robusta (length=276 residues).
cagaaaacatttcgaaacatgatcaaatcattggatatttccagtgtgaattctgcaaggttgtctctaagaagagtatt
tgaagaggttttcagtgatcgaaactgcaattggggtcgtatcgtaaccattgtagcattttctgttgaagtctcaaggt
ttggacagaaattgaacaatgaagatagcaaacactttccagaaaaaatatcagaatttgtttcagaatacataaacgaa
tatctgtctacttggattgtatctcaaggtggttgg
>gnl|bcl2dbcds|T1EKZ7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Helobdella robusta (length=213 residues).
cgagttctaaaagaaatgttctccgacggccacacaaattggggtaggattgctaccctttttgctttcggagcggctct
ctgtaaatattcccttgaaaataacaagcaggagcttatagaaccaatcacagactccatcgcactctacatttctacaa
ataaatccaactggataaggcaacaaaatggctgggttggtttttttttattt
>gnl|bcl2dbcds|T1FMT5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Helobdella robusta (length=573 residues).
atgtcatctttagaagcaactaataagattcttgcagctgattacatttacttcaagctgaggaaaagtagatttgattg
gccagtgagatgtcctgtcgatttgaaaaaagatggcggatgtgctgaagccaagttggctatgagaaatttgggagaag
agtttgaggagagatacagaggtgtattcaatgacatgtgtcaacaactgcacataacaccaaacaatgcatcagcaaca
ttcagagccatcattggagaattattttctgatggaatcaggtggggacggattgttgccctgttctcattttcaggttg
cctggcagttgaatgcatggagaggaagatgcctcacctggttgatgaagtactcacctggacgactgcgtacctcgatg
aacatctctccaaatggatacaagataataatggatgggatggctttgttgaattctcgaaaggagggcaaacgaaggag
tcaccctggccgtcattcaaaactttatgtggatatgctgtcggtgcactgggagttctcacgctgggcgccatcttgtc
tcaaagatcctga
>gnl|bcl2dbcds|T1FPP3_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Helobdella robusta (length=987 residues).
atgggtgacatcttcatcagtgaagaaaatgagaaacttcttggcggtcgagaagatgatgtagttgcagttggcggtaa
ttacaacgacgacgatgatagcatttctgacattactactactactactactactactactactactactactactacta
ctactactactactactgttgccacaactacaactatcgccactaacagtataaataacaacaatgcttataacaacggt
gataacaacaacaatacgaataatagtgacagcagcagcagcacaactcgaaatcgtagtagcacccaccagcgacaaaa
ccacgccaaccaccaacgtcgacatcgacgccatcagactagcagcgacgacgcagctgccagagacttattctacctga
acgatcgttttattacggaagaatttcgaaacaagtgtgcggaagttgcatatgacattgtcacttacgtctgccatagc
gggccctatcagccctaccctccccctagtaagaccactcgactgatgaggaaccttgtgaatgatttggcgaaaaatcg
cggagagctgatggatgatatggcatcccagatcgttttgaacgccaaatcgatggaacaactggagatcctactgaacg
aactggcctccgagatgttcaacgacaacgtcataacctggaacaggatagtgatgtaccatgccttctgcgcctacgtg
gccaagttctgcaaactccatgagagcattgaggacatcgaggaggtggtggtgaggattctcgtcgacattgttgttaa
cagactgggtctctggattgccacctgtggtggatgggctcagttcgacagtcagttccctatgctatgctgcatactcc
aaagtggatgcatatggaaagttctcctgttggtatgtgcattcattggcactatcgtcatcttctataaggccatacac
ttcctggatagttccagaaaaatctga
>gnl|bcl2dbcds|Q9HBF5_uncBCL2A1-03 Putative BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens (length=240 residues).
atggcgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaaccggcctaatttttctgactcttacgaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|Q9HBF5_uncBCL2A1-02 Putative BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens (length=240 residues).
atggcgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaaccggcctaatttttctgactcttacgaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|Q9HBF5_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens (length=240 residues).
atggcgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaaccggcctaatttttctgactcttacgaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A1E3K7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Hydra vulgaris (length=537 residues).
atgtcagatacaccaattaatttcaataccccggaagctaaaatcgcaaaagaagtagcgtatcaacttatacaaaaaaa
gacaggtaaaaatataaagaatcagcaaattcgtaaagaaacagaacttatgatgagattagtcgaggaaatagaaatta
aacacgaactgtttttgtcaaatatgtgtaaaagactgaacttaaatactgaaaatgctcaatcaatgtttcacacaatt
gcagaagagatattcagtgatggtattaactggggtagaattattgtcttatatgcgtttgctggaaaaattgcagaaca
ttgtagaaaatctaatgatgaacaaattattgataaaattgcattatgggttgcaggttttgtagccaaaaaaagtagtt
ggattcgtgattcaggaagaggatggaatggctttattgaaaactttgatgtcaagcaagactcgtgggttcagggattg
tttgctgctactttaggtttaggaaccatagctgctgcactttacatcaaaagctaa
>gnl|bcl2dbcds|A7LM79_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Hydra vulgaris (length=618 residues).
atgacaacgaattctttttctaacgtattatgcaatctggaaacaccttgtaacaaaaatgttgaaccatgtgataaaaa
aaatattgaaaatacattgaacaatgaaataaaattatcgaaaacatatatagacagtctattagtagcaacatatgttg
ttaaaaaacgtataggtattcagcaaaagtataataaaataggagaaaaagtatttgaattatgtctggagctggtaagt
aaacatgagactttttttaataatttgacaaatgaactaaatatatcaagagataacattaaagaagttataaaaatcgt
tttgagaaatgtcttgaaagactcaattaatttcggaagaataacttcgattttagccgtttgtatgatagtcagtgaac
attgttataaaaatgaatcgatgtcagacaaagtatgtttaattgtagaaactactgctgaaattatctatgaaaatagg
aaatggtttgaagctaatggtgcatgggatggactaatgaagtatttttttaatcctacagactacttttggaaaggttt
tgtagtaactactgttggattaggcgcaatggctggtctattgtatgcaaaatcataa
>gnl|bcl2dbcds|A7LM80_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Hydra vulgaris (length=579 residues).
atggctggacctcctaatgctcaagaagacaattacaaacgaatagttaaaagttatgttggagaaaagttaaggaaaaa
aggattaaaaattcgtggatatgaaggagaggaattaaaaccacctgtcattgaaatagcaaaaacactacaaagagttg
gagatgaacttgaatcagccaatactgatttttttaaaaatatgtgtgaccagttacaaataacaccaagtactgcatac
cccacatttcagtctattgcagatgagatatttgtttcaggtaaaaattggggtagagtagtagcatttttaacatttgg
aggtaattttgctgtacattgtgctctaagagcagatatgggagaagaatatgtagatagagttgttaattggatttcta
aatacatggccgttaatcttgattactggattaatcaacaaggtggatgggatgggtttttaattttctttgaaaagacg
aaaaataacgacgatgaacagggaagtcagagtgtttttttggtatctgcactagcgggactgggtgtgggcgcattact
tatgttaacgtttaaataa
>gnl|bcl2dbcds|A0A2D0PSX4_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictalurus punctatus (length=615 residues).
atggcaaaccaaagtccctatgataatcgggatatcgttgagaagtatctgtatcacaaacttttgaagcgaggctacgt
gtgggagttccgcgctggagcagaggaaggcgacggattgagggagccgccggcggaagttgtggatcgcaggccgcgcg
ccgtcttaccgctgcaccgcgttctccgggaggccggcgatgagatcgagcggacgtaccagcgcgacttcgcggccatg
tcggaccagctgcactttaccccgagcaccgcgcagcgccgcttcaccgccgtcatcgaggagctgttccgggacggcgt
gaactggggccgcatcgtggtcttcttcgagttcgggagcaccctgtgcgtggagagcgtgaaccaggagatggcgtccc
aggtggacaacatagcaagttggatgacggattacctgaacgggccattgcagaactggattcgggacaatggaggctgg
gatgcctttgtggagctctacagtcatcagagagcgtccatgttccacccctggccatatttaaagacagtctttggcct
ggcagcattgggagcagcgggagtcaccatcggcgccctcttttctcaaaagtga
>gnl|bcl2dbcds|A0A2D0QV33_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atgtcctgttggttaaggaaagagactctgatgttggcagaagactacatcgacttctgcatcgggaaccagcagatgcc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcacgttcctggcggcgtgcggcttgaaatcggaccggagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgctttcacgggcgttgtcgccaccgagatgtcctcccgagg
agacggagtggagaactgcaggaagctcgccgagaccatcgctgattacctggtcaaagagaggagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcatgtcagttacgattcgtccatgaagacggcg
ctgttcgcggcagcgggagtcggcttggctggactgaccttcctcctagtgcgctga
>gnl|bcl2dbcds|A0A2D0QV33_uncMCL1-03 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atgtcctgttggttaaggaaagagactctgatgttggcagaagactacatcgacttctgcatcgggaaccagcagatgcc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcacgttcctggcggcgtgcggcttgaaatcggaccggagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgctttcacgggcgttgtcgccaccgagatgtcctcccgagg
agacggagtggagaactgcaggaagctcgccgagaccatcgctgattacctggtcaaagagaggagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcatgtcagttacgattcgtccatgaagacggcg
ctgttcgcggcagcgggagtcggcttggctggactgaccttcctcctagtgcgctga
>gnl|bcl2dbcds|A0A2D0QV33_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atgtcctgttggttaaggaaagagactctgatgttggcagaagactacatcgacttctgcatcgggaaccagcagatgcc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcacgttcctggcggcgtgcggcttgaaatcggaccggagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgctttcacgggcgttgtcgccaccgagatgtcctcccgagg
agacggagtggagaactgcaggaagctcgccgagaccatcgctgattacctggtcaaagagaggagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcatgtcagttacgattcgtccatgaagacggcg
ctgttcgcggcagcgggagtcggcttggctggactgaccttcctcctagtgcgctga
>gnl|bcl2dbcds|A0A2D0REW4_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atggcctgttggttaaggaaagagactctgatgctggccgaagactacatcgacttctgcatcgggaaccagcagatacc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcatgttcctgtcgacgtgcggcttgaaatcggacctgagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgcgttcacgggcgtcgtcgccgtcgagatgtcctccagagg
agacggagtggagagctgcaggaaactcgccgagaccatcgctgactacctggttaaagagaagagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcacgtcagtcacgatttgtccatgaagacggtg
ctgttcgcagccgcgggagtctgcttggctggactgaccttcctgctaatgcgctga
>gnl|bcl2dbcds|A0A2D0SDG7_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=777 residues).
atgagtatgagcatgatgaagaggaccgctccgctgagtttactgtattgtggagtagaaaatggcggcggtgttagtgg
tgttttccgttctagagctccagtacagactttcccacagaaacgcgaggaggagctggacggctacacggaggaggtcg
acggaaggactgttaaaaccgtgattaatgagatcgaagtgccgctggagagccggttactgcttcaggacagcggctgc
gatgagcggatcataccggacctggagacggaaacccgggcgctgctcatgcagttgtaccgctgtcacatagggcttca
ccccgggaacaacacacacccagcgctgccgagcctgcagagagtggtggggaaactgctctgcaaacacaggatcacct
acagcggcatggtgcagcggctgttcgaccaggccaatggactggacagtgtgagttccgtgttgagcggtgtgttcagt
ggcggcgtggtgagttggggccgcatcgcgagtgttctggctctgggagccgtggtgtgtgagcggctgaagcaggagtg
tgtgaaggaacaagcagaggagtgtgtggacgtcgttacctcacacatctcctcataccttagcaaagacctacagcact
ggttcatcaacaacaacagctggaatggttttgtggagttcttccgtgtcgaggatcccgaggccacagttcggaacaca
ctcatggcagtggccggattgggaataggggcatgtctgttcacgctgatgcggtga
>gnl|bcl2dbcds|W5UHJ6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictalurus punctatus (length=615 residues).
atggcgaacggaaatctatacgataaccggcgcatcgtggaaaagtatctgaaccacaaactgtcgaaaaacggccacgc
gcgggagttccatcggtgccgcgcgagcagcctggacggccaggaggagcgcgagaaggagagctcgcgccgcgtaactc
tgcacatggctttgcgcgaggccggtgacgaactggaaagcttgtaccgaccggagttggcggagatggtgaagggcctg
cgcgcgacatccgtgggcacggagcagccgcggttcgtggccgtggcggacgagctgttccgcgatggagtcaactgggg
tcgcgtggtggcatttttcgagtacggcgcgatggtgtgcgtgcagtgcgctccggagaccgagaggaacgcgtgtgccg
agaacgtcgcgcgctggatggccgagtacctgaacggcccgctgaacgactggatccaggagaacggaggatgggatgcc
tttgtggagctgtacacgaggaaaaaggattcggtgttcagcagctcctggccgtccttaacaacgtccgtcttcagttt
ggcggcactgggggcagtcggtctcaccattggggcttatctgactcagaaatga
>gnl|bcl2dbcds|B7Q4U7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ixodes scapularis (length=858 residues).
atggccgtcaacgagaccgacaagacgcaggtttccgagatggtgaacgacttcctgcgctaccagctcaaccggcggga
cctgcagtggactacatgcccgccattgccccggcccagcaaagtggtcctcgttctccgaacgctgggcgacgaattcc
tggccaagtaccgcgacgagttcgtccagatgtgcggccggctcgacctgactccctcggtcgcccagaccgccttcctg
gacgtgctcaacgagcttttcagcgaggggattacctggtcccgagtggtgggcgccttcgctttcagcttcgagctgtc
cgcgcactgcgtcgagaagaactggtccgacctggtggacggcattgcgtcctggttgtcttcttacgtgtgcacgaggc
ttctgccctggatacaggaccacggaggatgggtaagcgatcctcctacccgcattccttccccgcgcgcgagcgccgcc
ttccacgacgccgggtttcggcgtggcggccggcgtttttcattgagccagtttctgctgccgcgtccaacggtctcgct
ccccctcaatggggggctgtcgtgtcgctcgctgccgccgcttccggctcgctcggcttatctcggggacgcgaactccc
cccactccctcaagccggccccagtttgctcgcataccgaggtctgggcggacgccgaacccccgcaagctccaaagagc
ggggcacggtctactcgtcgaagcggttgtgacgccgcgaggacgctgatcgagccgaaacctttggaaaaaatcaaaac
agccgaatgtggcgtgcatctcgtcgtaccttccggttcattcatacctagagactaa
>gnl|bcl2dbcds|V3ZZU7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Lottia gigantea (length=699 residues).
atgtcgactaccggaatggacagtaatttatatgcttctaaagtatcaaatatgatcgttaataagagtttatttgctga
attgagtaaacaatacagatcactgcccggagcggcgggcttgaacgacattggaaatgttgatgaatgcacacaaacgc
cagggagcagttcgcctttggaacaagttagaagagatgcagaagttattgcaaatgatgttgtattaacattcggtgca
gatgaaaccaagaaagctacaaacaaatattgcaaaacaatgcgcagaactgtgaaagaaatctcagagcgacatgacat
ttcattcaagggtatggtaaacaagctcaaagttgaggaatcaggacgtacttttgagacatttgttaatgtggcagatg
aaatttttgatgatggtcaaataaattggggaagaattgtcgcagtttatgcttttgcagctcgtttagccaactattgt
cgccagaaagatttaaatgattgcccagaaaaggtttccttatacgctgggaaatatgtgggaagtaaattagggaaatg
gattttagaccatggaggctgggatgcttttgtggaatttttccctgatcatggtgaatttgaagaaaaagtatggaaag
gtctcctgtttacagcagttggtttgggagctctagctacagtcgttgcttctcggtag
>gnl|bcl2dbcds|V4B1H3_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Lottia gigantea (length=561 residues).
atggatgacgaattgtcaaggaatattgtccaagactatgtgagttacagattgagaaaaaatggccatagatggcaaaa
tggacccatgatcgagggtgggccgagtaggatttgcttaactatgcgaagtttagctgatgaatttgaagataggtata
ggtctcaattcgaggacatggtaaatcaattagaaataactccaggaatagcttaccagactttcagatcggttgtgagt
gaattatttagtgatggcgtgaattggggacgaattgtagcattgtttacatttggaggttcaatatgtgtacaatgtgt
tgaaaataatatgcctcatgtggtggataatgtcgtggactgggttactacatactgtgataatgatttaaagccatgga
tagattcacacaactcatggcaaggatttgttgcattttacgacagagaacctgaaaggagaaatgatagcccctggaca
tcttttcgtaagatttgtggatttgcagcaggggcaataggtgttttaactttaggggccatcttaacccaaaagtcatg
a
>gnl|bcl2dbcds|Q1RPT4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Lubomirskia baicalensis (length=555 residues).
atgaccgctgtggatgggaagtccgaaactttgttccgggaacaaacaaggactatcgttcgtgcttctcttcgtagcta
ttctacaaccaaaggagatgacactgcgacgttcgtagcgacttgtgtggcagacattcggacgtgcaaccacgatgaat
ttgaccagatgtgccttcaacttgacgcctctccgacaagcgtgcagccgcgtgtggtacaaatcttccgcgagacgttt
aacgatggtatcaactggggaagaattgtcgcatttctggcctttatgagtcacttttccgcggattgtgagaagaagca
gctttacggttctgtcgaaagtatatgcgagtggtcagtggacctgataacctctcatttggaaaattggattcgggcag
aaggaggctgggttgctattaaaaaggctattgacgtgaagacaaagcagcagcaatcgcagcagcaacagtttttcggc
gccaacaacttcatgtcgttcgtgaaccgtggactcaaagcggcatatcgagcagcagtagcgagcgtctattaa
>gnl|bcl2dbcds|A0A2K5WP17_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Macaca fascicularis (length=237 residues).
acagcacaatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaacgctatcttctgaagcaatactgttgaccagaaagg
acactccatattgtgaaaccggcctaatttttctgactcttaagaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|F7E8W0_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Macaca mulatta (length=180 residues).
gtggttcaagaaaatggctttgtaaagaagcttgagcctaaatctggctggatgacttttctagaagttacaggaaagat
ctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactcttaagaaaacgattgcca
acacatacttctacttttaa
>gnl|bcl2dbcds|A0A2K6AUD8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Macaca nemestrina (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6AUD8_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Macaca nemestrina (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6E2M6_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Macaca nemestrina (length=237 residues).
acagcacaatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaacgctatcttctgaagcaatactgttgaccagaaagg
acactccatattgtgaaactggcctaatttttttgactcttatgaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A223FZ28_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Macrobrachium olfersii (length=921 residues).
atggccccagtaacagacaaaatcgttcccaaaaggactaatgatgacgaatctgacgaagggtttgtatctccttctgt
agatcgtgtaggtctaaggaaccataaagatactattaggcagtctgagagtgagagtggaaacagtagttcagacaatg
acagccaagctggttcttcttcctctacgacaacgtcgtcagaatcatcccaagcccttcagaattccgatgaagaaatg
gaagagaacacggctgcggcaacgggaacgacacactccgataacaaaaatagcaaagatgaagaagcagctcatgctaa
gggcaccaccaattctgacagccagaccgccgttacgccgtcagcgcccccagctgctgtcgtagccaaagacccagctg
cagaatcgaaagcagagagcttagcgaaatttgtagtgtacacgttattggagaaacacaatggagattctagtgacaaa
gtggaaaggaccttattgcggtgtgtgaaaatgatgatgcagaaacacgaaattcttttcaagggcatgatgaaacgagt
acaggtgacccgcgagactgggtacatctcctttgtgactgtggccaataccctcttcgaggaggataagatggtcatca
cctggagtaggattgtggcgctctatgcctttggtggacagttagctttatactgcaaagagaagggcatggaggatttt
gcgtgtacagtagcggactttatggggaaatatgctaaagaagtgttaacacctttcgtaacgaatataggaggatggag
caagatttgtgacgaattccccgaagaaacagacctcgagaatagagttagacgtgtcctatcgtggacagctgtgggtt
taggagtcgcagcgacagtttcatatttgacttcacgctaa
>gnl|bcl2dbcds|A0A2K5YIF7_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Mandrillus leucophaeus (length=237 residues).
atggcacgatcttggctcactgcaacctctgtctgccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctatcttctgaagcaatactgttgaccagaaagg
acactccatattgtgaaaccggcctaatttttctgactcttaagaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|F7CVK3_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Monodelphis domestica (length=420 residues).
atggcatctccagtatctactgatgtccctgctcttgcagctgattttgtacactacaaacttaaacagaaaacctatga
taacctattgggtctagaagagaacttctttgcaggtgtaccctcaagagagcctctacatttggccatgcactcttctg
gagatcaatatgaattcttctgtaacaacacgactattgatttagaccatgcaatgaagtattttaaccatgctgcagat
gaaatttttgaacaagggatcaccaggggttatatagtgggatttttctatttcagtgttgcatttggttcctgctgtat
tggttctacaaaaagttccccgattcagttagttaagaactggatggtgatttacatagagactaagttgatgaactgga
tccaccaaaatgggacatat
>gnl|bcl2dbcds|A0A109QG17_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Viruses] Myotis gammaherpesvirus 8 (length=534 residues).
atggcacatgctggaagaactgaatatgacaacagagaaatagtgatgaagtacattcactataaactggcaagtgctgg
acttggaggcgatgctgcacgaatgcctctatctgcagctacaggtggagacgaaaccgatgcaccagaccccctgcaag
aagctctccaggtaacaggtactggtattggattggtttttgcacaccgaagcggagctggattgggagactgtttgcaa
tttaatgaggaaaatgcacaaacaacgtttcttcaagttgttgatgagctcttccgagatggggtaaactgggggcgcat
tgttgctttctttgagtttggtggtgttatgtgtgtggaaagcgtcaatagaggcataccctccctcgttgacaacattg
ccgcgtggatgacagaccagctgggtggagaggttggtttgtggatccaagagaacggaggatggcacacttttgagcac
atgatcaacccccctcccgaacgccacaggaacaggcgatgcaatatcttgtag
>gnl|bcl2dbcds|A7S109_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Nematostella vectensis (length=429 residues).
atggtgaaggatttcatcggctacaaactacggcaaaataacatattcctggagggatttaatatggaatctccgaccaa
agcctcgaagcatttaagaattgtggctgatgaattaattgcggacaacagcgagctatttcattctatgtgtgaccaac
tgcatctcactccaatttcaacttatccaacttttgttggaatcgccaatgagatcttccaatcgggcaaaaactggggt
agagttgttgcttttcttgcttttggagcaacccttgcagtttattgcgcccaaagagaggaattacacgaattagtgaa
cgacattgtagaatgggtctcacgctacatggaccaaaacctgtcctgctggattcgagaaaatggtggctgggtaagat
ttcaacaagtatttctcgctttaaaataa
>gnl|bcl2dbcds|A7S9S4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Nematostella vectensis (length=492 residues).
atggctgctttacaggcgcagagaaaaccgtgttcggagacgttagagacgttgaaccgacaagctcacttcttggctca
agacctgatatcataccgtacaggcaatggaagaatctccacaagtctgacagcgcgcaatatgaggagacttagcgacg
agctcgaggaaaggcacgggccgctgctttgtaacatgtgcaatagtctaaacatgactgcaaattcggcgcacgagaaa
ttcgtgcaagttgctgatgaggtgttcaaggatggtataaactgggggagaatcgtcgctgtttttacgtttgggggtag
acttgcgcagttctgcgcgagaaacggtttgcacgatggcgtacgagaagtcgaggcttggttaggggactacatcgcga
atctgtcccactggatacagacccaagggggatgggtttgcacgtttgaaacgagccagtcgcacgattctgcaaacttt
gcacgtttttga
>gnl|bcl2dbcds|A7SFS9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Nematostella vectensis (length=543 residues).
atggaataccctcgaaacgacccaagacagagctatccagagcttgttcaccaagcacagcttctggccaaggatcttat
ttcgtatcgactcgggaaaaatccgaaaccacccaacgcaaatgcagaaactctacgcaaactggcggacaaaatcgaag
aacagtatcccgcacttttaaatcacttgtgtcataaattgaatatctctagaagcactgcgtacagcacatttgtagaa
atagcaggggaagtttttgctgacggggtaaattggggaaggatcgttgttttgtatgcgtttggtggtcggttggctgt
atattgcgaacaacataacatgaaagatcttgttcaatcagtaacagattgggtcggaaaatacatcgccgggctaagcg
aatggatcgccaacgaaggaggatgggatgggcttaaggagcaattcagggacaataatacaaatgatacaacttggtgg
aagggcgtcttcatcactacacttggaattgggacattagcagcactggtatacacaagatga
>gnl|bcl2dbcds|A7SPR2_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Nematostella vectensis (length=567 residues).
atgcctccaattgaaggatacgacaatgcaaacgctgttgctgcaagaaaaatgaaaactcccgaggagaaaatcgcaca
cgaactagcgaaggactttatcggttacaaactcgggaaaggaactcgactcaatacgaaatctgcgcttattctgagaa
agctcagtaaccagatcgaaaataagcatgaactattcttaaggaacatgtgtgatcgcttggacattcgacaacacaat
gctcccgagacatttaagcaagtagccgacgagatctttggcgatgggataaattggggacggatagttgttctttacac
cttcgccggaaaggttgcgaaatactgtcaggaaaatcagctagacaacgctgaaaacgtagcgacttgggttgggaatt
atgttgcctctaaatctgactgggtcaagaaagctggaggatgggaggcttttaatgagcaatttaaggatgtccaagag
gaacatgaaaagttctggtggaatagtttgctgtgcacaacactaggcctgggatctctagccgctgtcctctacatgaa
gagctaa
>gnl|bcl2dbcds|A0A0L8G405_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Octopus bimaculoides (length=639 residues).
atgggttcttcgtcaaataacaactccgagatgaatgtgccggtctctcggtatttgcttgaagattatgttaactaccg
tctaagaaggcagggttttacctgggaaaactgtccctgctttgaccgccgtccaagtaaagtggcaatcagtatgcgtg
ccatggccgatgagtttgaggaaagatatcatgaccaattctcaaatatgtgccaacaacttcatattactcagcataca
gcttactgcacttttcaggctgttattaatgaactttttagtgaccagactattaactggggtcgaattgtcgccctatt
ctctttcagtggagctttatcccttcagagtgttgagaaagaaatgccttatcttgtggacaacattgtagaatgggctc
atacgtacttaactgataacttgaacacttggataaatgcacatggtggatgggaagacaaagacaaaattgagagtttg
gataagttaaagattctttgtttggttcatgcaggcagttatttcatgttgaaccatccaacccagatcagattggagcc
tggtgcagccgctggctctccaggccttagtcaaaccgtccaacccatgccagcatggaaagcggttgttaaacgatga
>gnl|bcl2dbcds|A0A0L8HGC1_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Octopus bimaculoides (length=621 residues).
atggtctctgtcctgacgaatatcttttgtagtattaactcctcgcctgttatgcacccccttcaatccgtgattcgcat
ggataaggaagaaaatttgaaatcttgtagaaaagaggtgcctagaatggtcaaagacatggtgttgaacttcgataaag
gtcatttcatttcgcaacccgaatccgacatttgtgcaggcatgaggaaatcagtattagaaatttacaacatttataga
gatgcgttgtataaaaatgttgcccaattgttagacgaagttgcagatgacttaacaatccaaaaggcgtaccgttgcgt
agtggagaccatcctggaggatcgtaaaaatttacattggcgtcgtatctctatggttttcacgatgttggctgttttgg
ccgaagatcaacgatccaaacatcatgacctttcatgggaacagtataaccagatcttgataaaactctttaaagaacac
aagatcgacacctggataaatgataacagcggatgggatggcttcctggaacatattcagatgaaacacaagaataaatt
ggaagaatttatctggttgagtacaattggactctggtctttgtcagtttctggtttgtga
>gnl|bcl2dbcds|I3JTS4_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=675 residues).
gccggaatggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcggggatacgtgtg
gggatttcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggt
gccgagaagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgca
ggcatccacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggca
gctgcatctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggagtgaactggg
gccggattattgctttcttcgagtttgggggcacggtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtg
gacaacatcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatggagtgc
taatctgcagccactgtgtttaacatgccgtcctctgtttgcatcttggttgggactcttttgtctgcctttttcagacc
tgtgccttgaagctggcgcagactggggccgcaga
>gnl|bcl2dbcds|I3KLB2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=507 residues).
cccccctcccctctggcaaacactacaggtccatcagacccccccgtggccccgccccgcctgcaggctgtgctgcggag
cgccagcgatgagttggagcgacttcacggcaacgagctatctgcgcaggtgacagtgctgcgactgcgtgggaacggcg
gcggtgctgcacgtcggcgccacctgacggctatcagagaggagctgttcagggacggcgtgaactggggacgcatcgtc
accatgatggagctgggcggagctctgagtgccgcagccgccaagtcgggcgacgaaggtcaggtggatgatatcgccag
ctggatggaggagagtctggactctccgtcgctccgaagatggatccatgacaacggaggatgggatgcttttgtggagc
tgtatgagtccagacccacagacagcttctggtccctgaggacagtgttaggactggtcgtactgggagcagttggggtt
atactgggatttctattcagccagaaa
>gnl|bcl2dbcds|I3KLB2_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=441 residues).
cagggggcgatggctgccgcctacaacagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgt
ggcttggcctcagcacccccccgtggccccgccccgcctgcaggctgtgctgcggagcgccagcgatgagttggagcgac
ttcacggcaacgagctatctgcgcaggtgacagtgctgcgactgcgtgggaacggcggcggtgctgcacgtcggcgccac
ctgacggctatcagagaggagctgttcagggacggcgtgaactggggacgcatcgtcaccatgatggagctgggcggagc
tctgagtgccgcagccgccaagtcgggcgacgaaggtcaggtggatgatatcgccagctggatggaggagagtctggact
ctccgtcgctccgaagatggatccatgacaacggaggatgg
>gnl|bcl2dbcds|I3KWT0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus (length=597 residues).
gagatgcagtgcagtaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaacttccct
tctgaggccaaccaatgggggccaaaggactgagagagacctggcccaatctctgcctgcatacaatggcatagaggctt
taaaatcagctcttctagactcaggggagcagtttggttttctgttcacacagtcttttagggacgttgcttcgcacctc
agcatcacgccggacacagcccagcaatgcttcgagagcgtgatggaggagttgttcagggatggaatcaactgggggcg
tataattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgagtgagctggtacccgaca
ttgcagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctttaca
gagatatttgggaaagggatgtctacaaggagctctggggagtctctgaagagatggctatttgttggagtggccttagt
aacagggctgctggttggcatgctcatgacagattaa
>gnl|bcl2dbcds|H2MQI3_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias latipes (length=570 residues).
atggcgaacgtgtctaatcgcagtattgtagaaaagtacatctgccacaaactctccaagaggggctacgtgtgtgggct
gaacggcggccagcgcgagaatgctagcagcccccgcctcatcagagcggtcctgcgcgaggcgggagacgagctggagc
ggctgtaccagcgggacttcacggagatgtcgcggcagctgtacctcacctccaccacggcgaagacgaggttcgccgag
gtgattgacgaactgttccgggacggcgtgaactggggccggattatcgcgttcttcgagttcgggggcacggtgtgcgt
ggagtgcgcgtccaacgaggagatgagcacgcaggtggccagcatcgccgagtggatgacggagtatttaaacggacctc
tcaacagctggattgaagaaaacgggggatgggatgcctttgtggagctgtatgacagacagaaggaaaccgtcttcaca
tgctactggccgtccatcaagactgtcttcggcctggctgctctcggggcggcgagcctgaccattggagcataccttgc
acaaaagtga
>gnl|bcl2dbcds|H2MQI3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias latipes (length=609 residues).
atggcgaacgtgtctaatcgcagtattgtagaaaagtacatctgccacaaactctccaagaggggctacgtgtgtgggct
gaacggcggccagcgcgagaatgctgagagcagcccccgcctcatcagagcgctctcccgggcggacccgctcgcggaca
tccacagggtcctgcgcgaggcgggagacgagctggagcggctgtaccagcgggacttcacggagatgtcgcggcagctg
tacctcacctccaccacggcgaagacgaggttcgccgaggtgattgacgaactgttccgggacggcgtgaactggggccg
gattatcgcgttcttcgagttcgggggcacggtgtgcgtggagtgcgcgtccaacgaggagatgagcacgcaggtggcca
gcatcgccgagtggatgacggagtatttaaacggacctctcaacagctggattgaagaaaacgggggatgggatgccttt
gtggagctgtatgacagacagaaggaaaccgtcttcacatgctactggccgtccatcaagactgtcttcggcctggctgc
tctcggggcggcgagcctgaccattggagcataccttgcacaaaagtga
>gnl|bcl2dbcds|A0A3B3D197_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias melastigma (length=678 residues).
atggcgaacgtgtctcatcgcagtgttgtagaaacgtacatttgccacaaactctccaagaggggcttcgtgtgcggctt
ggacggcggccagcacgaggatgctgctaataacggctcgctcggtgaccgatccccgactccggtccgccgccgctgcg
acgcgggaacggggcctgacggcgagcgcagcccgcgcctcatccgcgcgcgggagccgcacgcggacatccacagagtt
ctgcgggaggctggagacgagctggagcggctgtaccagcgggacttcacggagatgtcgcggcagctgtacctcacctc
caccacggcgaagacccgcttcgccgaggtgattgacgaactgttccgggacggggtgaactggggccggattatcgcgt
tcttcgagttcgggggcacggtgtgcgtggagtgcgcgtccgacgaggagatgagcgcgcaggtggccagcatcgccgag
tggatgacggaatatttaaacggacctctcaacagctggatagaagataacgggggatgggatgcgttcgtggagctgta
cgacagacagaaggaaaccgtcttcagctgctactggccgtccatcaagactgtcttcggcctggctgctctcggggcag
cgagcctgaccatcggagcataccttgcacaaaagtga
>gnl|bcl2dbcds|W5P8E8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ovis aries (length=417 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgggg
ctacgagtccccccccccccgcccccgcccgggggtctcctccccccgccccccccgccgcgacttcgccgagatgtcca
gccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaac
tgggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggt
ggacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggtag
gtgctcgtctgggtgtg
>gnl|bcl2dbcds|A0A2R8ZBL7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Pan paniscus (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2R8ZBL7_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Pan paniscus (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2R9B9U7_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus (length=240 residues).
atggtgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaaccggcctaatttttctgactcttatgaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I3T949_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Pan troglodytes (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2I3T949_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Pan troglodytes (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|H2Q9X6_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes (length=240 residues).
atggcgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaaccggcctaatttttctgactcttatgaaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I3N7L6_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Papio anubis (length=237 residues).
atggcacgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctatcttctgaagcaatactgttgaccagaaagg
acactccatattgtgaaaccggcctaatttttctgactcttaagaaaacgactgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I3NCI6_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Papio anubis (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctaggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2I3NCI6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Papio anubis (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctaggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A3B3Q8Q8_uncBCL2A1-02 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=735 residues).
atgggaatgttgaaatttgcgtgtgcagctggagtgatggctgcggccgccggcacagcgtacctctaccggcggttcag
gaaaacgccagagcaggaggaagtgaatatggccacctcattgagggacgaaacccttatggtggcaaacgactatatgg
acttctgcattgggatcaagaggacacctcccagcgagtcagctaaagccatgcgatacatggcaaaggaggtggagaag
gagtatgagttcagactgcgccgtcttgtgcggtttttcttcatcaccagtggctttaacacctggactgaactcaagaa
tgtgatgctggaaatggttggtcatgaaagtatgagctggagccagattgttactctattcgccttcacgggaatactgg
cagttcaactttctaacgtagatgaagacgttgcctgcagcagacggctagcagaaatgattactgatgttcttcttgga
gaaaaagaagaatggattatccagaatggaggctggagggggttcgtggactatgtccacacagccaaaccagggtatcc
agattctcctgtgaagagagctctccttgcagctgcaaatgtgacaattgcctttcttcttgtacgttacagtatttcct
ttccatgttattcagagaaatgttttcctgaaagatttttgatcaagtttttcttaatttatgtacatatggttcactgt
tgtttcccccatgac
>gnl|bcl2dbcds|A0A3B3Q8Q8_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=606 residues).
atgggaatgttgaaatttgcgtgtgcagctggagtgatggctgcggccgccggcacagcgtacctctaccggcggttcag
gaaaacgccagagcaggaggaagtgaatatggccacctcattgagggacgaaacccttatggtggcaaacgactatatgg
acttctgcattgggatcaagaggacacctcccagcgagtcagctaaagccatgcgatacatggcaaaggaggtggagaag
gagtatgagttcagactgcgccgtcttgtgcggtttttcttcatcaccagtggctttaacacctggactgaactcaagaa
tgtgatgctggaaatggttggtcatgaaagtatgagctggagccagattgttactctattcgccttcacgggaatactgg
cagttcaactttctaacgtagatgaagacgttgcctgcagcagacggctagcagaaatgattactgatgttcttcttgga
gaaaaagaagaatggattatccagaatggaggctggatcagttatctgctaaaaagaaccctaccaggcttggtcccctc
agcaatggtaatcttcaagaaactgccaggaacatcaattagctag
>gnl|bcl2dbcds|A0A3B3QFC9_uncMCL1-03 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=570 residues).
atggaaagctgcgagtttctttcgcgtttctgggaggggaaaatgtcctgctggttgtcgaaggagacattggtgctggc
agaagattacttggaattctgcgttggagtgcagcggacgccgcccggcccggcctcagaagcaatgcgctgcttggcca
aggagattgagaagcagaacctgtccaaatttcactcccttgtgcaaacttttctggactcttgtggaccggaccgtagc
agcagtttgagaaaggtgatggcagagatggtaggggatggaaaattaaactgggggagagtggtatccctctttgcgtt
caccggagtgctggtgggcgagctccattcccgaggggaagggaaggactgctgcaggagactggcggagacgatagccg
actacctgggggtggagaaacaagactggctgttgcaaaatgaaggatgggacggattctgcaagttttttcacagctca
agaggacaaaatcacgagtcagccatgaagacggcgctgttcgccgctgccgggattgacaggatgaaaaccaggctgtg
tgtgtggtaa
>gnl|bcl2dbcds|A0A3B3QFC9_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=651 residues).
atggaaagctgcgagtttctttcgcgtttctgggaggggaaaatgtcctgctggttgtcgaaggagacattggtgctggc
agaagattacttggaattctgcgttggagtgcagcggacgccgcccggcccggcctcagaagcaatgcgctgcttggcca
aggagattgagaagcagaacctgtccaaatttcactcccttgtgcaaacttttctggactcttgtggaccggaccgtagc
agcagtttgagaaaggtgatggcagagatggtaggggatggaaaattaaactgggggagagtggtatccctctttgcgtt
caccggagtgctggtgggcgagctccattcccgaggggaagggaaggactgctgcaggagactggcggagacgatagccg
actacctgggggtggagaaacaagactggctgttgcaaaatgaaggatgggacggattctgcaagttttttcacagctca
agaggacaaaatcacgagtcagccatgaagacggcgctgttcgccgctgccggggactatccactttcagccgtgggaga
accgcagcaccgatgctctctggcttcaggtcatggtggctccagttccggcatgttgcgcattgctgctgattcccacg
taatcaagtga
>gnl|bcl2dbcds|A0A3B3QFC9_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=819 residues).
atggaaagctgcgagtttctttcgcgtttctgggaggggaaaatgtcctgctggttgtcgaaggagacattggtgctggc
agaagattacttggaattctgcgttggagtgcagcggacgccgcccggcccggcctcagaagcaatgcgctgcttggcca
aggagattgagaagcagaacctgtccaaatttcactcccttgtgcaaacttttctggactcttgtggaccggaccgtagc
agcagtttgagaaaggtgatggcagagatggtaggggatggaaaattaaactgggggagagtggtatccctctttgcgtt
caccggagtgctggtgggcgagctccattcccgaggggaagggaaggactgctgcaggagactggcggagacgatagccg
actacctgggggtggagaaacaagactggctgttgcaaaatgaaggatgggacggattctgcaagttttttcacagctca
agaggacaaaatcacgagtcagccatgaagacggcgctgttcgccgctgccgggagtgagaacatccggaggatcctgtt
tcatccactgcaggtgccctccagtggcagcgcctgccttagggcaccgttgcccaaacagcctttcaaaatcatgacgc
atgttctgtgtctagaaccagaacgacgtgttttgtccggactgcagggattcgagggcatggtaatttcagatgcctca
gccgtcgcccggggaacagcccagattaagagccacacacggataactgtcagcagcagaggcacacgggcctactattt
taacccaaacaaattttag
>gnl|bcl2dbcds|A0A3B3RFU8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=660 residues).
atggcaaatcaaagtacttttgatagtaggattatagtggagaattacatccaccaaaaactttcgaataggggaatcga
ctggggaatggactttggcgaggagacggagccgccagcgaacggctccacggacacggcgctctcacggcgactccaga
caggtgccgccgccgcccctattcgcagtcagacgacgcagtcggacccgcacgccgctcttcacgcagtcctgcgggaa
gctggggatcaggtggaaaggcgctaccgccgggacctggtggagatgtcggcgcggctgcacttgacacccgacacgac
ggagagcaagttcgccgcggtgatagaggagctgttcagggacggcaccaactggggccggatagtagccttcttcgagt
tcggggtagcggtgtgtgtcgagagcgtgaaccgggaaatgacgtcccaggtggaccacattgccaactggatgacggag
tacctgaacggacctctgcacacctggatccaggagaatgggggatgggaagccttcatggagctgtacggccgcaggcg
ggggtccagcgaagtgtggccgcacctcaaggccgtcgtcggactggtcgccctgggagttgtcggcgtccccatcgcag
cgtatatgatgctgaagtag
>gnl|bcl2dbcds|A0A3B3RKL3_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=894 residues).
atggatgttaccaatgtcaaattctttttagtgatcaactcctccataatgtccttgctgctctgttgcaaaatatggaa
tggctgtgtccgaattcaaggactgtattttgtaaaggacgtggtctacgaaggtgtagcctttattttattttttgttg
tatttctgacagtcgttgagaatccaaagcatagcaatgtttcttgttctctctttgcagtgaatatagccacttcattg
caggaggaaactcttatggtggcaaatgactacatggacttttgcattggaataaagaggacacctcccagcgagtccgc
taaagccatgcgatacctggcaaaggacgttgagagtatttatgggttcagactgcgcccacttgtgcagttgttcttgg
tcagcagtggctttgatacctggaccaaactcaggaatatgatgctggaggttattggaggtgaaatgatgagctgggga
cagattgtgtctctcttcgccttcatgggaatactggcagttcaactgtctactggggaagaagatgtcacctgcagtag
acggctagcggagatgatgacagatgttctcattggagaaaaacaagaatggatgatccaaaatggaggctggagggggt
tcgtggactatgtccacacagtcagacctggatatccagagtcacctgggaagacagctcttctcacagctgcaaatgtg
gcaattgcagggattgccagctccaaacgctcctcgtgcgtgtcacgccccctcattacctcctgtcggaatcctgattg
ttgtcacctgttccctattccgtttgccttgtctcttgtatttagtcctagtctcagtcagtcttgtcagattagacatt
gtgatgtcatgtaa
>gnl|bcl2dbcds|A0A3B3S872_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=576 residues).
atggccacctcattacatgacgaaactcttatggtggcaaatgattacatggacttatgtgttggaatcgagaggacacc
tcccagcgagtccgctaaagccatgcgatacatagcaaagaaggtggaggatatgtactggctcccactgcgccgtcttg
tgcagtcattcttgagcaactttcccatacacacctggaccgaactcaggaatgtgatgctggatatggttgatcgtgaa
aatatgaggtggtcccagattgtgattctcttcgccttcacgggaatgctggcagttcaaatgtctaccatagatgaaga
tttcacctgctgcagacggctagcagacatgatcactgatgttcttagagaaacacaggaatggatgatccagaatggag
gctggagggggttcgtggactatgtccgcatattcagaccagaatatccagtgtcacctgtgatgagaggtctcttcaca
gctgcaaatgtggcaattgcctttcttcttatcaattatctgctaaaaagatccctaccaggcttggtcccgttcaagaa
actgccagaaacatga
>gnl|bcl2dbcds|A0A3B3S872_uncBCL2A1-02 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=684 residues).
atgggaatcatgaaatttgcgtgtgccgctggagtggtggctgccgccgctggtacagcgtacctctaccggcggttcag
gaaaacgccagagcaggaggaagtgaatatggccacctcattacatgacgaaactcttatggtggcaaatgattacatgg
acttatgtgttggaatcgagaggacacctcccagcgagtccgctaaagccatgcgatacatagcaaagaaggtggaggat
atgtactggctcccactgcgccgtcttgtgcagtcattcttgagcaactttcccatacacacctggaccgaactcaggaa
tgtgatgctggatatggttgatcgtgaaaatatgaggtggtcccagattgtgattctcttcgccttcacgggaatgctgg
cagttcaaatgtctaccatagatgaagatttcacctgctgcagacggctagcagacatgatcactgatgttcttagagaa
acacaggaatggatgatccagaatggaggctggagggggttcgtggactatgtccgcatattcagaccagaatatccagt
gtcacctgtgatgagaggtctcttcacagctgcaaatgtggcaattgcctttcttcttatcaattatctgctaaaaagat
ccctaccaggcttggtcccgttcaagaaactgccagaaacatga
>gnl|bcl2dbcds|A0A3B4B2U1_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus (length=579 residues).
atgggcggaagaagcaacccatcaagagacgaaggcggaagaacaaggctcagaagtgacgcacagtgggttctgaagca
atggtgcacggcgttagacgcaaaaaggacaatgtttgataaagttttaagaggagttttagaggacatggtagatgagt
tggtggcaggtgaatacgattttgataaggcagctgatgaagtaattaacatcaatactctcctgttagaagatgttata
gttgtgacatttgtcgcagaaagtgtatttgaagacggcgtagtgaactgggggcgtattattgccatgatggtatttgg
agccgctctaggccgaaagttgcagacagcagggcaagagcacgcaatggagaaggtggtgaatgaattggtggtgttct
tttggaaaaattattttagtggagctgttcaggacagaagagaaattataggcaaagtaactgctgtgttaaggaggtat
aaagtagtgcccccgttgtcaacgcgtgttaaagtggcagtagtagcctgcctcggcagcctaggtatggcactgggtct
taggcggtggtttaggtaa
>gnl|bcl2dbcds|A0A346RRN2_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Perna viridis (length=555 residues).
atggatccaacagggactcgctatctagttgtggattatgtgaattacagactgaataataatggagtacaatggggcca
atgtccgtcccttttaccacaaccattagaagtgcatctgactttaagggataagggcaacgagctcgaagcgcgataca
aagctgttttccaacgacgtattgacgatttacatattacagagaatacagcctacccagtgtttcggacggtagtggac
gaaattttcaatgggggaattaattggggacgcattgtagctttgttttcgtttgggggatcgttagctacagcatgcat
gaaaaaggacttacctcagttgatagattctattattgagtggattactatatatatagacgaaaatttgtcagcatgga
tacaatcacacggtggatggcaaggctttgtggaatactataaccaagcacagaaccataatgacaatcagtggaatttg
ggagaatttgtacgttatggggccattggtgtggttggtgcccttgcccttggtgctttactacaaagggtatga
>gnl|bcl2dbcds|S4RB20_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Petromyzon marinus (length=435 residues).
gtccagagggcgatgagggcgagcggggacgagttcgagaggcgctacaggagcgccttcgcacagctgcccgcccaact
gcaggtcagccaggccacgctgagggcccgcttctccgacgtgctggacgagctcttcagagacggcgtcaactggggcc
gcgtggtcgccttcttcgccttcggcggggcgttgtgcgccgagtgcgtggacaaggagctgcccggcctggtgagcagc
gtcgccacgtggatgacctcctacctggaggaccgactgctgtggtggatcgacgataacggcggatggaaggctttgat
ttatgttgcccctacccacctttattttttttccttcgtctggagttcattgtgtcttaaaaatgtaaaactgcacggat
attgtaactcattaatgaatttgctaccggcagca
>gnl|bcl2dbcds|A0A087YSS6_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Poecilia formosa (length=585 residues).
atggcgaacgactacaatcgcaatattgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaacaacggaggtttaggtgaccattcaccgactttggttcggcgctgccgcg
atgcaggaccggggcccgacagcgacagcgacccccaccgcctctgcaggcggatctcgcagtccgacccgtacgcagac
atccaccgggtcctgcgcgacgccggtgacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggacgaggttcgccgaggtcataaacgaactgttccgggacggcgtgaactggggtc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaagtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatggcctcttaa
gcgctttgcagatttgttgcaacgg
>gnl|bcl2dbcds|A0A087YSS6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Poecilia formosa (length=690 residues).
atggcgaacgactacaatcgcaatattgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaacaacggaggtttaggtgaccattcaccgactttggttcggcgctgccgcg
atgcaggaccggggcccgacagcgacagcgacccccaccgcctctgcaggcggatctcgcagtccgacccgtacgcagac
atccaccgggtcctgcgcgacgccggtgacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggacgaggttcgccgaggtcataaacgaactgttccgggacggcgtgaactggggtc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaagtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatgggatgcatt
tgtggaactgtacgacagacaaaaggagtcggtcttcagctgctactggccgtccatcaagactgtctttggtctggctg
cactcggagcggccagcgtcaccatcggagcgtaccttgcacaaaagtga
>gnl|bcl2dbcds|A0A3B3UCB9_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Poecilia latipinna (length=690 residues).
atggcgaacgactacaatcgcaatattgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaacaacggaggtttaggtgaccattcaccgactttggttcggcgctgccgcg
atgcaggaccggggcccgacagcgacagcgacccccaccgcctctgcaggcggatctcgcagtccgacccgtacgcagac
atccaccgggtcctgcgcgacgccggtgacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggacgaggttcgccgaggtcataaacgaactgttccgggacggcgtgaactggggtc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaagtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatgggatgcgtt
tgtggaactgtacgacagacaaaaggagtcggtcttcagctgctactggccgtccatcaagactgtctttggtctggctg
cactcggagcggccagcgtcaccatcggagcgtaccttgcacaaaagtga
>gnl|bcl2dbcds|A0A3B3Y903_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Poecilia mexicana (length=690 residues).
atggcgaacgactacaatcgcaatattgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaacaacggaggtttaggtgaccattcaccgactttggttcggcgctgccgcg
atgcaggaccggggcccgacagcgacagcgacccccaccgcctctgcaggcggatctcgcagtccgacccgtacgcagac
atccaccgggtcctgcgcgacgccggtgacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggacgaggttcgccgaggtcataaacgaactgttccgggacggcgtgaactggggcc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaagtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatgggatgcatt
tgtggaactgtacgacagacaaaaggagtcggtcttcagctgctactggccgtccatcaagactgtctttggtctggctg
cactcggagcggccagcgtcaccatcggagcgtaccttgcacaaaagtga
>gnl|bcl2dbcds|A0A3B4F099_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pundamilia nyererei (length=471 residues).
aactgttggtggctaagaaacagcacagggacatcgaaggccagctgtactgtgtggtgtgtggccaaaaaaaaggcacc
ccccatcacgtgggctgcccacacagatatccattgggcaacaccggccaatggaaaggaggcggacggggtcgccgacg
tggcaaagcagctgtttttggacgggtttgtaaactgggggcgtatagtgtgcttggtcgcatacggcgcggccttgtta
cgaagaccgaatgctgccgttagcgcgccgacatcggctcaagcccgcgggatcggcaacgccatagccgcacacataat
aaacgatcacatggattggtttgtggccaacagtggctgggtacgtcatgttatttttctattgaaccaggagtcgtact
cgctgccgagcggactgttgttcgtctgtggtattggattgtctctgttggcacttgcattgaaacaataa
>gnl|bcl2dbcds|A0A3B4GNW6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Pundamilia nyererei (length=681 residues).
atgtgccagatgatacactggtatgactggcaggagagatcgtggcatttgattagcctggccctgcagaggaggtccag
agtggagatgcagtgcaggaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaactt
cccttctgagtccaaccagtgtgggccaaaggactgagagagacctgggcaaatccctgcctgcgtacgttggcatagag
gctttaaaatcagctcttctagactcaggagagcagtttggttttctgttcacacagtcttttagggacgttgcttcaca
cctcaacatcacgccagacacagcccagcaatgcttcgagagtgtgatggaggagttgttcagggatggaatcaattggg
ggcgtataattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgggtgagctggtaccc
gacattgcagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctt
tacagagatatttgggaaagggatgtctactaggagctctggggagtctctgaagagatggctatttgttggagtggcat
tagtaacagggctgctggttggcatgctcatgacagattaa
>gnl|bcl2dbcds|A0A3B4H3M3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pundamilia nyererei (length=597 residues).
atggccggcgcctacagcagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgtggcttggcc
tcagcgccaggccaatgacgagagagccccgcgtccagaccctcctgtggccccaccctgcctgcagaccgtgctgcgga
gcgccggcgacgagttggagcgactttacggcaacgaactgtctgcgcaggtgacggtgctgcaactgcgtgggagcggc
ggtggcgctgcacgccggcgccacctgacggctatcagagaggagctgttcagggatggcatgaactggggacgcatcgt
cgccatgatggagctgggcggagctctgagcgccgcggccgccaagtcgggcgacgaaggtcagatggacgatatcgcca
gctggatggaggagagtctggactcgccgtcgctccggagatggatccatgacaacggaggatgggatgcttttgtggag
ctgtatgagtccagacccaccgacagcttctggtccctgaggacagtgtgtggactggtcgtactgggagcagttggggt
catactgggatttctattcagccagaaacaaaactga
>gnl|bcl2dbcds|A0A3B4H829_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pundamilia nyererei (length=555 residues).
atgccacaaccgcggacctcagagcgcgtggtgagaccgtgctggctgaacatagacgcatcgggtccacgtgttatcgt
ctctgacgggttgagccaaagtgtccggcatctcaacgacccccccaccttcggatccggttggttggcagacgccgcgg
gcatgattcacatcgcagggtcgtacgacacgtacaaatgcgtagactgcaacatagtcttgtcgggatacaaaaaggcc
gacagaagcctaaacgagcacgtccttcgcatgctctcactgcagaccaccgccgccgctgaagtgtcaacggtcacacg
tgtggcacgcaccttgttttcagacggcattataaactgggggcgcatagtaagccttgtggcttacggcacagtgttac
tgcaagcgtcgaagtcaaccttgggacccgagtgctgtagcattggcgctccaccgccgctgcttttatactgcccttcg
cagggcccggtcggtgggtcggtcgggtctttctccgacccaccgaccgggcgcagtgttgtaacacttacttaa
>gnl|bcl2dbcds|A0A3B4CHC5_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pygocentrus nattereri (length=627 residues).
atggccagcaagaaggagaaggtgtacgacagccggcagatagtggagaagtatctgcaccacaagctggccaagagcgg
tcacgcgtgggaggaggaaggaggagaagagggagaggaggatgaagaagaagaaggaggaggaggagaggagaacaggg
tgcaccaggctccggcggccgtgcacggagcgctgagggaggcgggggacgagctggagcgcctgtatcagtccgatctg
accgagatggccgggcgcctggagctggagcccgcggtggcgagccggagcttcgcggcggtggccgacgagctgttccg
ggacgaggtgaactgggggcggatcgtggcgttcctggagttcggcgcggccgtgtgcgtggagcggcggcgagcggccg
agagcatcaccgccgacgtggcccgctggatgactgagtatctaaacgggccggttctgaagggatggatccgggacaac
ggaggatgggatgccttcgtggatctgaacggccggcagaaggagtcggttttcagcagttcctggccgtccatagtgag
cgtgttcagcctggcggcgctgggggccgtgggcttcaccataggagcgtatctcgctcagaaataa
>gnl|bcl2dbcds|A0A3B4ENK0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pygocentrus nattereri (length=711 residues).
atggccaatgaaagtccctacaacatccgggacatcgtggagagatacatccagcacaaacttctcaagcgaggctacgt
gtgggagttccgccccggcgccgccgccgccgccacggccgacgacgacgacaacgacgaggccgagatgccgcgcgcag
ggcccgcgaggctgcaccggttgctgcgcgaggccggcgatgagctcgagcgcgcctaccagcgggacttcgccgccatg
tgggaccagctgcgcgtggcgccgagcacgcagctccagcgcagcttcgtggccgtggccgaggagctgttcggcgacgg
cgtgaactggggccgcgtcgtggccttcttcgagttcggcggcaccctgtgcgtggagagcgtgaaccgcgagatggcgt
cgcaggtggaccacatctcgagctggatgaccgattacctgaacggaccactgctgcagagctggatccgggacaacggt
ggctgggatgcctttgtggagatctacagtcagcagagaaggtctattttccacccctggccctatctaaagacagtgtt
tggtctggcagccctgggggcagcagggcacttgttctctcagcatcgcactgccctgcccaggaccaaggctctactgt
ctactccatggagcggagctgtcctttgtccacatgcttgtgactggagcgggagaagaaacaaggattaa
>gnl|bcl2dbcds|E9PU78_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgaggtgaatggagccactggccacagcagcagtttggaggcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggacacttttgtggatctctacggga
acaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggttcctgacgggcatgactgtggctggtgtg
gttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q7TS61_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Rattus norvegicus (length=240 residues).
atggagccattggtgggacaagtgcaggattggatggtgacctacctggagacacgcttggctgactggatccacagcag
tgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactggg
catcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q9WUI5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgaggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggacagttttgtggatctctacggga
acaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggttcctgacgggcatgactgtggctggtgta
gttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A2Z5U635_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Viruses] Rhinolophus gammaherpesvirus 1 (length=501 residues).
atggacccgcccattatttcgctggtcaccgatgtcatgaaagtcaacctaggggagttggggttcacatggactggaca
tggacctccaatccccggatcccctgaaccacttcaaataccgctcccggtagggtgcctgttggacgcaatgcataaat
gttccggtatgtatagggaaagatttggacccctccttgatcacgcgaacccgcagttgggtgcctacgatatgcaacta
ggattattttcaagcgaactcttccgtgacggggtcaactggggtagaattgtggcatttttttcttttggaagctccat
gggcattaatctagccaagcagggcatcaatcccggacccatgtgccggatgttatctgaaaccttggagagattggctg
gtccgtggattagagaccatgatggatgggacggtttagttgattggtggctgacaagaggagattggtccatctggaac
cttcaatgttcaattctgtaa
>gnl|bcl2dbcds|A0A2K6P5R9_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Rhinopithecus roxellana (length=237 residues).
atggcgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaaattacaggaaagatctgtgaaatgctatcttctgaagcaatactgttgaccagaaagg
acactccatattgtgaaaccggcctaatttttctgactcttaagaaaatgattgcccacacatacttctacttttaa
>gnl|bcl2dbcds|R4TE41_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Ruditapes philippinarum (length=567 residues).
atgaggatggacgaggatgacttttcgatcggtactagtggaatagtggcggaatatattacttataaagtacaacaagc
tggatttgattaccaagtctcgccaacaaggaactgccctaataacaaagtaatagacactgtgaagaaactgtgcagcg
agtttgagaaacggtacgagtcgcagtttaccgaaatgtgcgaaacttgctcgcaagttgaattaaattctgcaaattat
gtagctgttttggaccaattaattgtcaacggacttcattggggtagggttgttgcaatattttcatttgcgggtgctat
gtcagtgtactgcatgaaaaagaaccagaaagagagggttgactggatccgagagtggacttgccagttcatggacagta
aagtagaaaactggataaatgaaaataatggatggagaggacttatagatttttacacgaatggcatcaagaaaccagaa
gaaaaaacaaatggatggggatctgttctcatcggtggtgccctcggagcttttgcgctcggtgcgctcataatcaataa
ggcatga
>gnl|bcl2dbcds|R4TGI6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Ruditapes philippinarum (length=696 residues).
atgacgacaacaagtccaacatacggtggaattaaatcattaggagggaatggaggttttcataacaattcaaatctgtt
cgctgaaattcataaacattggggacttttaccaggaaaccaagggctcaataacatcaaccaggaaacacagacaacag
gttctatgttatcaccattagaaaatgtaagaaaacaggcagagataatagcaacggctgttgttgttaattttggtctt
gactgtgaaaagaaatgtccggacagattctgtaaaacaatgagaaaaacagtgcaagaagtttcagatagacatgacat
agctttgaaatcaatggtcaacaagctgaatcttgatgattctaatatgtttgctacttttgtaaatgttgctgatgaaa
tcttcgaagacggtcaaataaattggggacgagtcattgttgtttacgcgtttgctgccagattaaatgcctactttaga
caaggaaatccaacttacgaagagaagatatctctttatgttggaaagtatgtcggtaataaacttggacgatggatttt
agataatggaggatgggatgcatttgcagactttttctcagatgaaaatgcagtagaggataaaatttggaaaggacttt
tatttacagcaactcttgggggattgggtgcattagcagctgttatgtcccgatga
>gnl|bcl2dbcds|B5X106_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Salmo salar (length=591 residues).
atgtcatgcgggctgtggaaagaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgg
gtcctggaaagccccgcccggtcctcctcccagcgactcggctgcagccatgcggcgccaggcccgggacatggaggcca
agcaccgggcccgcttccacgccctggcacacagctttctgtgccaatgcgggccggacccctgcgcctgtctgaggagg
gtgatggaggagctggtgggagacggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggt
cagagaactacagggagaggacatggaccaggggctgggtaatggcatgggcctgggggggaaggagagctgcagggcac
tggcggagaccatagcagactacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgt
aagttcttccacacagcaagagaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcat
cgcagggttaaccttcctcctggtccgctaa
>gnl|bcl2dbcds|A0A132A3U0_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Sarcoptes scabiei (length=453 residues).
atggattctcaattgatgtctttgatcaaagatttctataattctcaattcgaattgatgaaagcaccacgcccgttccc
gaacgtttcgagtggaacgataacgatgacgacgccgtccgattatcatcaaattatctcatcattgaaagctttgggac
gattgatacagaaaaattatgaaaaacatttcttggagatcatcaaaaaatttgataaaaaaattgagccaagtaattgc
tgtgcatctttctactgtctcagcaatgctatgtttgtgaaaggaatccaatggaatcatattgtcacatattttgtctt
cagtgcttatttcgctcattatgctgatcaggaagatgccgcatcagtgtcggatgtcgcactctggctttgtagatttg
tctctgaacgccttctcgattggattgaaaccaatggcggatggaatttttaa
>gnl|bcl2dbcds|G4VMZ9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Schistosoma mansoni (length=897 residues).
atgcctcaaaatgaaattcaacctacaagtaatgaaccatctgctactactaataccaccacactaccatccacttctct
tgtatatcatcaatctcatcagtcagttccgtcaacatttatatctgcacgattaattctatgcgccagaaatctcgctg
accattttgagtctagatatcgtgatttattacaatccattaatcgagatgtagcgcgtttaaataatgatcaaagttgt
acagaagatacaaacaaaacgacaatgattagtgttaatgataatgttactaatgtgcgtgataccaacacaagtgtaaa
gagtgatagtaggattggtgatggtgatgccagcggtgctgctagtcatgtgagcgatgattcacttcaaactcgtttag
aaatggcacgatgtcaatttcatagtgttctagaagaattatttcttgagcgtattaactggggtcgtataattgcaatg
ttggcatttttgcgaacattatgtgaagttgttgaagagaacaataaacatatgaattattcagtttcacatcagtcagt
tccacagtctcatgatgtttcaaagtcaactgatttgcctattatttcttgtgaacaacttgagcataatgatgatgtta
catctgattgtaataaacagttatcttctactgatccatctgcttcctgcagtgataaaaatacggataaaaaattacaa
gataaagatttggaaacttccatggatcctcatcagtcgaatgttagtaacttacatttaatgtcgttcacaagaccttg
tgcagctgattatactttgtggacagttgagtttatacatggtccccgaggactttggaattggatatcatctcatggaa
attgggtgagcaaatag
>gnl|bcl2dbcds|C9WPR4_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=555 residues).
atgtcttatgttaaaactatgacactaaattatgatgataaagattacattcattctttgctcaacggtcttgttaaatt
agcaggcatagatcaacagcttaatgatcgaaactgtctaaatgatgatatagtacaatgcttgcacagtttggtggtag
aagctcaagaccgtggtaaagatacaatatctaatttttcatcgattttaaataaacctacggatgatgataaaaaacag
tcgttttatattgtggtggaatctttatttaacgattgtatacggtggtccagagtaatagtagcttttatgtatataat
tcaagttctcaaaatttcgaaaaatgaatacaaaaaatattttgagtggtcagttgagttgatcctaaccaaaatatatc
catgggtcagagaaaatggaggatgggagcaaatagtacagatatcgaaaaaccgaaaccacctcgaagaagtcacagaa
acaatgaaacaattcggcaaagtggccctggggataactggtttgtttgcattgggaaaatggatattcaattga
>gnl|bcl2dbcds|H2DL19_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=579 residues).
atggaagatcgaatcatttttcaacccagtggtcttttaaaggattctagagtttacaatatcgaatgcgacctagattt
cttgccccctatcgacatcattgacaagattatgattgattttgttatgtatagaattagcatccgaggatttccggatt
tgaacatattcccaaacaaggttggaagaactaagtaccattccgttacaaatgagattctaaacaaattgactgacaag
gcagatgaattcgaaaggcaatattatccaagatttgaaaatcgaaaaagtctgttagaaaaaattcctgaaagagcatt
tttagattttattgacactcttcatggcattttcgaagataatcaaattaattggggcagaattattggctacttcacgt
ttgtagggtcgtattgtacggcctgcattgagcatggaatggtcagaattgtatacaatttagtggaatatgcaataaaa
tatatgaatacaaatctctccggttggatgtcaagcaatggtggatggcgaggacttggaatggctttatcaaccgaatc
atttgaattaagattctga
>gnl|bcl2dbcds|A0A1W4YU74_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus (length=531 residues).
atgtcctgttggctgtcaaaggagaccttggtgttggcagaagattacttgcacttctgcactggcagtcagcagagccc
tcccaatgagtctgcagtggcgatgagacacttggccaaggagatggagcagcagtacaagtcaaaacttcaaccactcg
tgcaaacattccttgactcctgcggacctgaccatagtgcaagtcttagaaaagtgatggtagagcttgtaggagacgga
aagttaagctggggaagaattgtctctctctttgcttttaccggaatgctggtcaatgaactctgttcccaaggagaagg
caatgactgctgcaagagactggcggagactatagccgactaccttactgtggaaaagcgagagtggatgttgcagaatg
aaggctgggaaggattctgcaagttttcccgcagtgccagagaggtgaacaaagagtctgcaatgaagactgcacttttt
gctgctgctggtgtaggcattgcaggaataacttttctctttgtgcgttaa
>gnl|bcl2dbcds|A0A2U9B3E4_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus (length=378 residues).
atgattgtcgcgttggagcgcacgaagggccccgggaccgtaacccaggaggccaaggcggtctttgtcgatggtgttgt
caactggggccgcattgtcagcctggtgagcttaggggccgcgatctgccagagccgcggtttcgaatgccgcggatcgg
gcgaaaacgcaacggagactgtggaagaagagatagcttcgtatttgctcaaagaacacgaagactggctggtggcaaac
gactattcggatggattcgtggccttctttaagacaccagggacctcagacagggaggatctcggacaattgcctctccg
acccatacttgccattggagctgtgcttttgacatgtaccctgttccgtttcaagtga
>gnl|bcl2dbcds|A0A2U9BDX9_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus (length=1401 residues).
atgtgtgaccagacgttcgtggcggtcacctttggcccctgcgacaactgcacgaaggccagtcccctgatgaacatcta
catcaagactgaggccatcaactactgctccctctgcgtggaactgatggcctgtcaggggctccagaagggggaaaccc
tggcgtctctgaagacggagagcgacggtctgaagaagaagctggaggtggagcggggcaagctgaacgacgtggagttg
caccaggtggcagagaagaccgaggtgttgggcgctctctccataaagaccagacgagtcctgaagggccacggggccaa
ggtgctgtgtatggactggtgcaaagacaaacgtcgtctcgtcagctcttcacaggacggaaaggtgattgtgtgggatg
cattcactctcaacaaggaacatggggtgtccctgccatgtacatgggtaatggcgtgtgcttatgctccctcaggttgc
gctgtggcgtgtggtggactggataacaagtgctccgtgatcccgctgtcgctggacaaagatgagaacttggccgcgaa
gaagaagtcggtcgccatgcacaccaactatgtgtcaggctgcaccttcaccaactctgacatgcagatgctgacctcca
gtggtgacggcacatgtgccctgtgggacgtggagagcgggcagctcctgcagagtttccacggtcacacagctgatgtc
ttgtccctggacctcgccccgtctgaaactggaaacacctttgtctccgggggctgtgataggaaggccaacgtgtggga
catgcgctctggtcagaacatccagtcttttgagagccatgagtccgacatcaactgtgtgaagtactaccccagcggag
acgcattcgcttctgcttctgacgatgccacatgccgtttctatgatctacgagctgaccgcgaagtagccgtctaccag
aaggacagcatcgtgtttggtgcttccactgtggacttctctctgagtggtcgcctactcttcgctggttacaatgacta
caccatcaatgcgtgggacgtgctgaagggaaatcgtgtctccatcctgtttggccatgagaaccgcgtcagcagagtca
aattgtcacctgacggcacggccatctgctcggcctcatgggacaacaccttgcgggagctggcacaggggcccgggagc
tgcaggggactggcagagaccatagccgattacctgggagaggagaagaaggactggctgctggagaacgatggatggga
tgggttctgtaagttctcccgcagtgccagagagatgagccaggactcgtcgatgaagacggctctgtttgctgctgctg
gcgtggggcttgccggactcaccttcctgctggtgcgctag
>gnl|bcl2dbcds|A0A3B4U6P3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Seriola dumerili (length=678 residues).
atggctgccgtctacaccagccgggacatcgtggaggatttcctccactacaagctgctcaacaagggagtggcctggcg
tttcccgccgccaccgcgccaatcaggcgctcagcgcgtacaccaggaagcttcgtctgctacgtcgaggacatcaggca
gaggcgtcgctccaggtgatgcccagcaagatccctggtcaacccctcctcggctacaggtcgccctgcggtgcgccggt
gacgagctggagtgcagttaccgtggcaacctctcagcccaggtgtcagcactgctgccctgcagggatggcgacggggg
cggcagccggtcggcgcgaaggcaaagccttactgtggtcagggaggagctgttcagggacggcgtgaactggggacgca
tcgtggccatgatggagctgggaggcgctctgagtgccgaggtggccaagacgggcggggcgtggcaggtggacgacatc
gccaggtggatggaggagagtctggactcaccgccgctgcagggatggatagaagacaatggaggatggaatgcctttgt
ggagttgtacggcgagtccagacctccagtcagtttctggtctctgaagacagtgtttggactggttgtactgggagcag
ctgggatcgcactgggagccctgttcacccagaaataa
>gnl|bcl2dbcds|A0A3B4WW18_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Seriola lalandi dorsalis (length=639 residues).
atggcgagcgagtataatcgcaatattgtggaaaagtacatctgccataaactctccaaacggggatacgtgtggggatt
tgatgatgtccgagatgaagatgctgctaataatggctcaatagttgcccctccaccgactttggtccgccggtgccgtg
aagccaacaccgggcctgacaacgacagctcacctaacctctgcagacggctctctcagtccgacccgcacgccgagatc
cacagagtcctgcgcgaggctggagacgaacttgagagattataccagccggacttcacggagatgtcgcggcagctcta
tctcacctccaccacggcgcagagaagattcgccgaggttatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgttgagtgcgcggccaaggaggagatgacatcgcaggtggacaac
atcgtggagtggatgacggagtatttaaatggacctcttaacagctggataaaggataacgggggatgggtaggtctgat
tccgtctgcttacaagtgttcagttgggattaaaacgtgcattctgacccgacacacaatatcgaaagcacatctgtaa
>gnl|bcl2dbcds|A0A3B4YFW5_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Seriola lalandi dorsalis (length=495 residues).
atgatgacatcactcgtctcctccttggtcattggctgtctcctcctagatccctggtcgacccctcctcggctacaggt
cgccctgcggtgcgcctgtgacgagctggagtgccgttaccgtggcaacctctcagcccaggtgtcagcgctgctgccct
gcggggacggcggcggggacggcagccggtcggcgcaaaggcaaagccttactgtggtcagggaggagctgttcagggac
ggcgtgaactggggacgcatcgtggccatgatggagctgggaggcgctctgagcgccgaggtggccaagacgggcggggc
gtggcgggtggacgacatcgccaggtggatggaggagagtctggactcaccgctgctgcagggatggatagaagacaatg
gaggatgggtaggaagacaacaagtcctctttttgtctttcttcttttggctcaccgtatcctgggttaccaataaactc
acatcactacagtga
>gnl|bcl2dbcds|A0A3B5AUF2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Stegastes partitus (length=618 residues).
ggggcgatggctgcagcctacagcagctgcgacattgtggaggattacctgcactacaagctgctcagcaggggcgtggc
ctggcgctgctcgccgccgcccggcaggacaggtggtcggaggccggggcgagctgaaacatcacacctgcaaggcgaga
aggccgtcactgttgtcatggccgcgctgcggagcgcgggtgatgaggtggcgcgctgttgccatggtaacctgtgggcc
cacgtgtcggcgctgcggctgtgtgagggcggcgcggtgcagcggcgcagcctggaggcggtcagcgaggagctcttcag
ggacggcgtgaactggggacgcatcgtggccatgatggagctgggcggagctctgagcgccgaggctgctgaggctggag
acatgcgtcaggtggacgccatcgccggctggatggaggacagtctggactcgctgccactccgagggtggattgaagac
aatggaggatgggatgcctttgtgcagctgtatgagtccagacctccagtcagcttctggtccctgagggctgtgtttgg
actggttgtactgggagcagttgggatcacactgggagccttgttcacccagaaataa
>gnl|bcl2dbcds|T1JCZ5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strigamia maritima (length=615 residues).
atgggcgataacaggacggtggaaatgaacgaagaaacgcgctccctagttcaagactttattattcatagcatggagga
gcgcggcgttgcagttccacaaccgccattgcgttcgccgacgccactgagtaggaaattgcgccaagtgacgtgcgaat
tcgaacagaaaaataggacgtcgctggacgaaatgtttgtgacactgcaagagcagggaaaccagcaaatggaagtgaat
gcgcacttggcgttccagggagtcatcaatgaactgtttcgtgagggcatcacctggagccggattgtggcgatgttcgc
gttcgcgggtggcctcgccgtccgattcacgcaggacttggaccagatcgtcgaagacctcacccaattcatcgagcaca
ctttacagtcttggatcgccgataatggcggttgggtaaggcaacatatgcgacttttgtttattgttggattcgcctcg
gccagaacgaacgcattctcgtggaacaggaacaacattcctggcatatcagatgggttctcgaaaatgcgaattatttt
atcattttcgattatcgattggtctgaaattcgctttttcgggtttgttacgtaa
>gnl|bcl2dbcds|W4Y4Z4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=675 residues).
atgactgaatcaattcttgccgcttcttcgcctcagaaaagcaactacaacaagcagttgggccaaaacttgtttttcaa
tggaaatgttagaaaggaacagccacccagccctgatgaagaagtgaatggacatcctcttgtggaggaaggcgagtcgg
ggttaattgctcgacagcttggggacgattacatttcatacaaagttggaaaacaacatggtcgccgaccgccttgccag
catgcagagacattaaggagagttggggatgaagttgaggaaagatacgccatcaccctcaatggtttagtgaacaattt
ggagtatgatccggacaaagatggtgaagaggcatttactgcgagtttgaatgccatgtttgaagaagggtcatgtaact
ggggacgtgttgttatggtttatgtttttgcagcccgtctcgcgaaatattgccaggaaaatggaaaaggttatcacgta
ggaagcttggcagattttgctggaagatatgttgcatcaaggttaaccccctggattaataagcaaggaggatgggaaaa
gtttgatgaaagtttcaaggccaaagactggaaagaaaaggcagcattcaactcgttgttagtgacaggggcttttcttg
gtggacttgccgcgctcagactattgatgaaatag
>gnl|bcl2dbcds|W4YMX7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=498 residues).
atgccactttggaaatggatctgtaaaacgacttttatagatctgtcaaagttacggatgaatgatagtgaaaccactaa
actgattgaggattactgcatacacaggatacgaaaggagagcatcgaacttgcgtcttaccaacatgtgagcagagagc
cctatgctcccgtcgcagccagaatgagagaaataggtgtaacatggggaaggatagcagctttaatagcgttcagcggc
cgactttctgtacattgtgctagtaataacttagaagacttagttcccagtattataggctggacatccagatacattgg
cagtaaattattaccgtggatgcaagaccatcaaaattgggatgggttcatggcattttttgaggagaatggcaaagtcc
gggcgagggaaaccgtctcgtcgatcatgtcgtcggcgtgccgcttcgcagttttcggcgcgggaatcgcagccctcgct
tgcctactcagaagatag
>gnl|bcl2dbcds|W4Z8J6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=462 residues).
atgccagatatcagcacagcaagcatagttgcagattatctacgttacagactgcaatgtttgggaaatggtgttgatgc
agaggaaaatgattgcttgtcaaccgtcatgtcatcagtcgaaaatgttccagaggatcttcatgaagccatcgtaaatc
tctccgaaaaactcatgaatgactacagagattctttcagtgatatgccaaatcaactgaaaattactgaaaatactatc
agttcgacatttaaggccgttacaagtgagctttttgtagatggtgttatttcttggggacgaattgtagcatttttctc
tttcggaggagccctgtgcgagtggtgtcaagagaaggacatcccccgggcgttccccacggttgaagagctgatggtcg
cctacatcaattctcatctcatcacatggattcatgcgaatggcggatgggtaatgaaataa
>gnl|bcl2dbcds|Q5TJD7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Suberites domuncula (length=657 residues).
atgacaaccgagtcaccatcactacatggctcatctgggggtaataacaacagagaaagggtggacaataactatggcct
gcctgatgacatgactatagacaacgaacacatagaggagctggcacgctcttacattgttaatttgttgaggagagaag
gtctcaatcacatagccgaccaatttgcacccgtgggatcgactagagctaatggctaccagctcattgagaggatcgta
tgtcaattggaggatgaacgttcgcagcagtttatcgatattctaagaggtctggaaattgaccaacagaatctacggat
aacataccagacaatagtaggggagatctttaatgatggtgttcactgggggcgtatagtagcatttctagtgttttctg
gccatctagctgtgcattgtgctcgcagcaatggtttggagaatagagtgagagatgtggtagaatggacagaagctgag
atgagactgcgtgtgcatcaatgggttgaagaccgaggaggatgggaggcattcattcaacactttgatagaaatacctt
gtggaattttgacttgtccacaatagcggtatctgctgcgatgatagctgctctgtttgcagctggtctgtttacagtaa
aaaggtttttgagttga
>gnl|bcl2dbcds|Q9N754_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Suberites domuncula (length=657 residues).
atggccgaagctttgttgacaaccataagtatgacacatccagacaatgactcggagcttattcttgtcatgcaacagag
tgcttgtctaagttatcacttgacctactatctcctaaatcaaggtgggataaaactaaatggttatgctggcaacggga
gaacctctcatacgaggaacagactaaccaacgataagaaattcagagaagcaatttcaactctcgagtccagctgtaaa
caaatgaaaagcaaatatcagcaagagattgaaggattggttaaaactttagacatttccgacacacaattatatactaa
ctttcagcacgcagctaattcattaatggacggggacattagatggggaaggatcgctgtgttattcttttttacgagtg
tcttggctaaacgtcttcataaggacggacactcgcaccagatatcaagtcttatcggatggttaacgacattcttaaac
gataatgcaacttcgtggattctagaaaatggcggatgggcagcaataaaggattcagtaaacgttgaagaaaaacaaca
accgccaacagttgagaaagcacaaaagtctagttggctaacgatagcggctgtcggagtgggagccgtggttgtgggtg
ccctagctatcagataa
>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-03 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=528 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggagaacggcggctgggacacttttg
tggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggttcctgacgggcatg
actctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-04 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-05 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1Z1EDU3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Tachysurus fulvidraco (length=615 residues).
atggcaaaccaaagtccgtatgacaatcgggatatcgttgagaagtatatttatcagaaacttttgaagcgaggctacgt
atgggagttccgcgctggagcagaggaagacgacggattgagggagccgccggcggaagttgtggatcgcaggccgcgcg
ctttattaccgctgcaccgcgtactgcgcgaggccggagatgagatcgagcgcacgtaccagcgcgacttcgcggccatg
tcggaccagctgcacctcacacccagcactgcgcagcgccgtttcaccgccgtgatcgaggagctgtttcgggacggcgt
gaactggggccgcatcgtggtcttcctcgagttcggtagcaccctttgcgcacagagcgtgaaccaggagatggcgtccc
aggtggacaacatagcaagttggatgacggattacctgaacgggccattgcagaactggatccgggagaatggaggctgg
gatgccttcgtggagctctacagtcatcaaagagcatccatattccacccctggccctatttaaagacagtctttggcct
ggcagcactgggagcggcaggagtcactatcggcgcccttttttctcagaagtga
>gnl|bcl2dbcds|H0ZU95_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Taeniopygia guttata (length=111 residues).
ggctttgtggactttttccgcctggaggacctggagggcagcgtccggaacgttctgatggccttcgcgggggtggccgg
cctgggggccagcctggcctacctgatccgg
>gnl|bcl2dbcds|H2RZ55_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=525 residues).
atgtctaatagagagctggtagagaactatttaatctacaaactctctcagaaatacccaggcactgtgtctccacccgc
aggtactggcagagaggctttgaatgcagctcttcggagcatggcaaataagtacgagcgggactttatggagcaagcgg
gtgacctctccccatacgtcgccgtgactaggaacaaggcaggttttaacaaggtgatggacgacatgttcagagataaa
atcaactggggaacagttgtaggtctttttgtcgtgggcggcgccacttatgtgcaatctttcgagggcggcgcaagtga
accggtttgccacgttgcagactggatgacagattacctggaccaacggattaatccatggatcgagagtcaaggaggat
gggtgaacaggcgtaaatggatactgggcggactggtggtactggctggtgttttgatcattgttacaaaaaattatggt
acattgcgtaaggcattttcaaattttatgtcttattggtcatag
>gnl|bcl2dbcds|H2SIR7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=642 residues).
acatcattgaagtcagtgtattttttaaattgcaaaacccaaaggaatttagagctggtggagaactatttaatctacaa
actctctcagaagaactactcaggcactctgctcagaccaaagggtgcttcaagcggtttgctggtcgatagagagagca
gtggagcgtctccatccgcaggtactggcagagaggctgtgatcgcagctcttcggagcatggcaaataagttcgagcag
gactttattcagctagcgggtgacctctcctcatacgtcgccatgactcggaaccaggcatgctttaacaaggtgatgga
tgacatgttcaggggtgaaatcaactggggaacagttgtgggtctttttgtcgtgggcggcgccatttgtgtgcaatctg
tcgagggtgacgcaagtgaaccggtttgccacattgcagactggatggcggcttacctggacaaacggattaacccatgg
atcgagagtcaaggaggatggaagcctgcacaaagtcaggaagaaaggcgtaaatggatactgggcggactggtggtgct
ggctggtgttttgatcattgttacaaaaaattatggtacattgcgtaaggcattttctcacttcatgtcttattggtcgt
ag
>gnl|bcl2dbcds|H2SKE0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Takifugu rubripes (length=678 residues).
atggagagggagtgcaatcgcgacattgtggaaaactatatctgccataaactgtccaagcgcggcttcgcgtggagctt
tgaggatgtccaggacgaaaacgcagcaaataacggctcggttgttgcccccgcaccgactttggtccgccggtgtcacg
aggccggcaccgggcccgaccgcgaccgcgggagcatctcccacccctgcaaagagccccccgcgtccgaccagcacgcc
gccatccacagggtcctgcgcgaggctggggacgaacttgagaggttgtaccagccggacttcacggagatgtcgcgcca
gctctatctcagctccaccacggcgcagaggaggttcgcggaggtgatagacgaactgtttcgggacggggtgaactggg
gccggattatcgctttcttcgagttcggaggcgcggtgtgcgcggagtgcgcggccaaggaggagatgagcccgcaggtg
gacaacatcgcggagtggatgacggaatatttaaatgggtccctgaacagctggatacaagataacgggggatgggtagg
tgtgattcagcgtcgctcccgttttcccagattaacacgggaattgggagacgctccgttagctgcacgccagcactttc
tgacccggaactcctctgctgacggacccaggcgttga
>gnl|bcl2dbcds|H2UHW0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=519 residues).
cgtgaaaagtgtttgttcggtaactatttaatctacaaactctctcagaagaactacccaggcactctagagagcagtgg
aacgtctccatccacaggtactggcagagaggatgtgaacgcagctctttggagcatggcaaataagttcgagcaggact
ttattcagctagcaggtgacctctcctcatacggcgccatgactcgtaaccaggcaagctttaacaaggtgatggacgac
atgttcagtgatgaaatcaactggggaacagttgtgggtctttttgtcgtgggcggcgccatttgtgggcaatctgtcga
gggtgacgcaagtgaaccggtttgccacattgcagactggatggcggcttacttggacaaacggattaacccatggattg
agagtcaaggaggatgggtgagtgtaaaggagagagactcaaaatacagcttcctttgccctgggattctggaaagcgcc
ttgaaacaattttgtttgtataagacgctatataaataa
>gnl|bcl2dbcds|H2UHW1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=663 residues).
tcaatttctcagcgggtgtgtcgtcgagtggggaaaaacggtgagccacaggaagcgggtggtggtgcaccagagctggt
agagaactacttaatctacaaactctctcagaagaactacccaggcactctgctcagaccaaaggatgcttcaagcggtt
tgctggttgatagagagagcagtggaacgtctccatccgcaggtactggtagagaggctgtgatcgcagctcttcggagc
atggcaaataagttcgagcaggactttattcagctagcaggtgacctctcctcatacggcgccgtgactcgtaaccaggc
aagctttaacaagttgatggacaacatgttcagtgatgaaatcaactggggaacaattgtgggtctttttgtcgtgggct
gcgccatttgtgtgcaatctgtcgagggtagcgcaagtcaaccggtttgccacattgcagactggatgacagtttacctg
gacaaacggattaacccatggattgagaatcaaggaggatgggtgagtgtaaaggagagagactcaaaatacagcttcct
ttgtgctgcagttagagatttgatgaccaaaatacaacctttattttttttttttagaatgactaacggccatgagttga
ttaggggaattgtattcatctga
>gnl|bcl2dbcds|A0A346FR88_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Tegillarca granosa (length=702 residues).
atggctacggacagtcagcatattggggaaaataatggaaaagtaacaaatatatacagtttgaagaagggtagtttatt
cgccgaaataaataaacaactaggtttacttccaggatttcaaggattgagtcaggatttgaataaattagaccaagaga
cacaaacaccaggcagttctacaccactggaaaatgttcgtcatcaggctgaagtaatagcttcggatgttataaaatcg
tttgttggtgattgtgataagaaacccccaaatagatactgtaaaacaatgagaagaactgtcaaagaattgtcagagag
acatgatattgctttcaaaggaatggtgaacaagttaaatgtcaatgacactactgcgtttccaacttttgtttcagttg
tagatgaaatttttgaagatggacagataaattggggtagaattgttgctgtgtatacatttgcagctagactgtcaaaa
cattgtaatgaggaaagtccagattgtgatgaaagaatagcactttacgcaggaaaatatgtggccagtaaattggggag
atggattctagataatgggggctgggaggcttttgctgactattttccagagcaaggtgccatggaggataaattatgga
aaggtctggtctatacagctgtcggacttggagcactggccacaatggtggcttctcgataa
>gnl|bcl2dbcds|H3C1U2_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Tetraodon nigroviridis (length=546 residues).
aaaatgtcgtgcgggctgtggaaagagaccctggctctggcggaggactacctgtctgtgtgctgcgccagccagatgag
gagcctggcccaggacctggagcagcagcaccaggctcgcttccactcgctggcccacagcttcctgaggcagtgcgggc
tggacccctgctccggcctcaggacggtgatggaggagctggtgggagacggacacttgaactggggaagggttgtttcc
cttttcgcctttactggcgtgctggccagactgatgcaggagcagaagagcaccaagccggggccggaccccgggctgga
gcaggacctgggacaggcgcctggagcctgcagggcactcgccgagaccatagcagactacctgggggaggagaggaagg
actggctgctggagaatggcggatgggagggcttctccaagttctccctctccgcccgggaggtgagtcacgactcatcc
atgaagacggcgctgtttgccgccgccggggtcggtctggccgggctcaccttcctcctggtgcgc
>gnl|bcl2dbcds|H3C3G9_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Tetraodon nigroviridis (length=573 residues).
atggcgagagagtataatcgcgacattgtggagaaatatatcttccataaactgtccaagcgcggcttcgtgtggagatt
cgaggaggtccaggaccaaaacgcggcgaataacggctcggtagttgcccctgcaccgactttggttcgccggtgtcatg
aggccggtaccgggcccgaccgcgggagcatcccccacctctgcaaacgcaccccccagtccgagcagcacgccgccatc
cacagagtcctgcgggaggctggggatgaacttgagagattgtaccagccggacttcacggagatgtcgcgccagctgta
tctcacctccaccacggcgcagaggaggttcgcggaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggccgcggtgtgcgcggagtgcgcggccaaggaggagatgagcccgcaggtggacaac
atcgcggagtggatgacggaatatttaagtgggtccctgaacagctggatacaagataacgggggatggagaaggttcaa
aaaggtgactgga
>gnl|bcl2dbcds|Q4SCG3_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis (length=441 residues).
cttcggaaggtgacggatgattttgagaagaagctcactcgagcatgtggcgatctctcctcgtacttgccctccaagat
cagccaccaaaactttaacaacacaatggaccagattttcgaaggcaacgtgcactggggagtcgtcattggtctgttcg
tggtaggcggcgccatgtgtgtgcagtgtgttaggaacaaccacgaggaactggtctgccacattgcagactggatgacg
gcctacttggatgagcatcttgagccctggatccagagacaaggaggctgggaggactttacccggagatatgaaacagt
tgatgaacggagccaatttgaaagaggagcgaagctttgctttctgactctgctgctggttggggggtttgtcattttta
ggaaatataacgtgttccatcgcttactgcgttttctgtag
>gnl|bcl2dbcds|Q4SCG3_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis (length=624 residues).
atgtctcacactaacagagagctggtggagttctatctgaactacaaactgtctcacagcaacttcctgacgtctctgcg
ggcatcagcggacgcgtggcagagccccaggattagccgcagagaccgcagcggagcctctccgtcctcggacgctggtc
gccgggctgtgaaggcagttcttcggaaggcgacggatgattttgagaagaagctcactcgagcatgtggtgatctctcc
tcgtacttgccctccaagatcagccaccaaaactttaacaacacaatggaccagattttcgaaggcaacgtgcactgggg
agtcgtcattggtctgttcgtggtaggcggcgccatgtgtgtgcagtgtgttaggaacaaccacgaggaactggtctgcc
acattgcagactggatgacggcctacttggatgagcatcttgagccctggatccagagacaaggaggctgggaggacttt
acccggagatatgaaacagttgatgaacggagccaatttgaaagaggagcgaagctttgctttctgactctggtgctgct
ggttggggggtttgtcatttttaggaaatataacgtgttccatcgcttactgcgttttctgtag
>gnl|bcl2dbcds|E5S8V8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Trichinella spiralis (length=651 residues).
atggtccttcatgattttgtcgatggtgaatgggtaggtgaaagatcaaattgttttgatatagcaagagacgctgtaga
atcagaagcatgcgtcattgcatgtgattatatcaatcatcgattgttaaaatcgaattatgtttggaccgattgtccag
acctgccgaagccaaattgtatatcgttatgtatgcggacgatgggtgaagaattggagcagcgctatgaacgcagcttc
aaaagcatgagcgaaacgcttcagatttcgccaactaccgcttatccgacatttctggcaatatgcgatgaattgttcaa
cgacggcatacgctggggtcgcattgttgctttgtacgcttttggcggaagtctttctcttcagtgcgtccgtaacaata
tgccagaattagtcagtagcatcgcagattggctggcaatgtatactgagacgcatttgtcgcagtggatcattgaaaat
ggcggaaggctttgtgaagttctatcacgaaagctctgtaaaacaacagacgtcatacagagaggtgatcgcaagcgttg
gcgttgtatgcgctgcgattggagtgatggccatcggtataatgatggcgaaacattgaatgtgaagacaaagtatacaa
aagtagattga
>gnl|bcl2dbcds|A0A1B1IJN9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Trichoplax adhaerens (length=636 residues).
atgacatcttccttcgatgaggcatcttctcagaaaataaaaactttaaaacctacattgactaacttcaaaggtactaa
tggtttcttggatgacgaacagttcttagtttataagaatataatcaaggattatatccagtctcggttacttaatgaag
gtcttttagatggaccgtatcgatgtgatataaaagatgttaaaaccaagaaagtatccgaacgcttgaaagaagttgga
aatgaattggagggaaaatttaaggattctttcagtaatatgtgcgaaagattaactattacggatacaactgcttaccc
aacgtttgtgggtgtcgttaatgagttattttctacgggtatcaactggggtaggatagtcgcatttattgttttttcaa
gtaggctggcgatccactttaaacgaaatgggatgcctgaatacgtgaagagcgtttatggatgggttgcaagatatatg
catacgaaattatctacctggatcgaagcgaacagatcttgggatggctttctggatcatttcgacaagaaaaatgagaa
tgaaaagtctagtatttttactgcaactatggctgttgctattggtacttgtgcatactttctgtttaatagataa
>gnl|bcl2dbcds|B3RSA4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Trichoplax adhaerens (length=648 residues).
atgtctcctgaacgcgaaaaaatggtagaaactaacatagcaaactcagaaagtacggaaaattacgctaacggtacgtc
ctatttgcaacccgtaaatgacgaagaaatgtgtcgagaatcgagacagttagcgtatgattttgtctatgaagtcgttg
gtgagaagaaccctgtatcttatattcgtaaaagatcttctagtcgctgtatcaagaaattaaatcgcatgacaaaggtc
atgttagagcgtcacgatatcccatttaaaagtgcttgtacgaagatgaaactaagtaaagatgctccagtaagaagaat
gctgcaatcgattgctgctgaaatgttccgtaatggctgcaactggggacgtataactgcattatttgccttatgtcgaa
aacttgcaatcaatagtaaagagcttggatattacgacatcatatacaaaatagcaggatgtttggctgatatattaact
ggacaactacatagttggatcgctgccaagggaggctgggatgagtacgtgagctactttagagatacagaagatgtaca
agaagatgcaaaaaaatttcttatgtatactactttagccctcacggcttcttttgcagtggcgcttgcagtgtgggaaa
gatggtga
>gnl|bcl2dbcds|A0A144KBE2_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Urechis unicinctus (length=705 residues).
atggatgtaacagactctgttatcgtaccggaaaggtttagtcttcagaagaacaacaattattcacaacggaatgggtt
tacgacgaccgaccgtccgattttgaaagcggaatcaaaatccaagatggtgtctatcaccacgaacttggagcaatcca
cgcaaacgccgaagtctctcaatgttgataatgtgaagcaagtggcaaaggaacttgcagttgacatcgtgaattatgtg
tcgggacataaacattcgaaaccagtcaatcagcacgccattacccttcggagaaccgtggatgaactatctgagaaaca
cgaaattgtgttcaattccattgtcaagaaactccaaccgttgacacgagacactgcagtacagaccttcttcaatgtga
tggatgaaatgtttagggactgcagctataattggggtagagtcgtgtcagtttatgcatttggtggtagattggccaaa
cattttgtggatatcaaggccactgactttgttgagaaagtggccgaatgcttggggacatttgttgcagagaaattgag
caaatggatacatcaacaaggcggctgggatgcattcgatgcctacttccctgagcgctccagcatggaaactgtcatct
ggaaatcgttggttatgactgcatttggtctgggggcccttgccacgatggtagctgtgagatag
>gnl|bcl2dbcds|A0A3B5MJB9_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xiphophorus couchianus (length=639 residues).
atggcgaacgactacaatcgcattatcgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaataacggaggcttaggtgaccattcaccgactttggttcggcgatgtcgcg
atgcaggaccggggcccgacagagacagcgacccccacagcctctgcaggcggatctcgcagtccgacccgtatgcagac
atccaccgggtcctgcgcgacgccggggacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggactaggttcgcggaggtcataaacgaactgttccgggacggggtgaactggggtc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaggtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatgggtaggtct
gattcagcctcttaagctgggcgctctgtggctttatttacagctcagaaccgaaagtacacgtgagatcggtcattaa
>gnl|bcl2dbcds|A0A3B5QUY0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xiphophorus maculatus (length=690 residues).
atggcgaacgactacaatcgcattatcgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaataacggaggtttaggtgaccattcaccgactttggttcggcgatgtcgcg
atgcaggaccggggcccgacagcgacagcgacccccaccgcctctgcaggcggatctcgcagtccgacccgtatgcagac
atccaccgggtcctgcgcgacgccggggacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggactaggttcgcggaggtcataaacgaactgttccgggacggggtgaactggggtc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaggtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatgggaagcgtt
tgtggaactgtacgacagacaaaaggagtcggtcttcagctgctactggccgtccatcaagactgtctttggcctggctg
cgctcggagcggccagcgtcaccatcggagcgtaccttgcacaaaagtga
>gnl|bcl2dbcds|A0A067RGX7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Zootermopsis nevadensis (length=396 residues).
atgttggacaaacatgtactattgtttactagctttgcaaaacgtttggctcgtaccccggaaaatatttcggaacaatt
cttggtagtgtcagaagaattgttccaagattgcgtgacatggagtcgcataattgccctgtatgcacttgctgggcgat
tggctttatattatcgagagaacaacatgcagaaactggctgaaagtattccacagtgtatggcacattgcatcgcaggg
aagattgcttcttttgtaataaagaatggaggctgggaacaactttgtgtagagtttccaccaaaaaaggacttgagtgt
gaaagtgtggagatctttgctggtgacaggagctgctctggggatagtggcagcactcttaatggttcattcataa
© 1998-2019