Dataset for CDS MCL-1 of organism all

[Download (right click)] [Alignment] [Repertoires]

199 sequence(s)

>gnl|bcl2dbcds|A0A3Q1EQB9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=MCL-1 (length=840 residues).
atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctttccgcaaaatggagtcgtggagggaccgat
gcactatggatccggagattcctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaatcttggctcca
gtgataccccaaaacggccgaagaacctgggagtgaacgggtatgcgccaaaaagccttcgacaagacagcgacagtatg
gaggacggctctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctccagttgtccaacaggggacga
gttgctggagaatgacacgaggcaactcattcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggacaaacacagatactcatacaatggtatgatc
aacaaactgtcgctggatgacataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggac
aaccaactggggtcgtattacgagcctggtggccttcggggcggtggtttgtcagtacttaaaggagaggggcagggaga
actgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaacaactca
tgggacggttttgtggagttttttcgagtagcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
tgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3Q1EQB9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=MCL-1 (length=1152 residues).
atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctttccgcaaaatggagtcgtggagggaccgat
gcactatggatccggagattcctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaatcttggctcca
gtgataccccaaaacggccgaagaacctgggagtgaacgggtatgcgccaaaaagccttcgacaagacagcgacagtatg
gaggacggctctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctccagttgtccaacaggggacga
gttgctggagaatgacacgaggcaactcattcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggacaaacacagatactcatacaatggtatgatc
aacaaactgtcgctggatgacataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggac
aaccaactggggtcgtattacgagcctggtggccttcggggcggtggtttgtcagtacttaaaggagaggggcagggaga
actgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaacaactca
tgggacggttttgtggagttttttcgagtagcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
tgctggtattggggcaacactggccctgctgatcagactggaaagtaaatttggggaaacccagaggaccgggagaggag
ccggaggcaaacgatggatccaggggggccggaggaaaccacaggagaggaaccggaggagacacgatgcctgcagggac
cgaggcagggggcaagggaaccgacagaactggagggttccaaggagggggaaccaggagggacacggagccggcagggg
tccaagacggaagcaaggagacagactgggcaggagtggtccggacagcgggatcctccaggagaggagaacagagaaaa
agacgttagtctcagaaatacttgtcacgtaa
>gnl|bcl2dbcds|G1L3M8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1005 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
gggggnatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccggtg
cggtgattggcggaagcgccggcgctagtcccccggntggcgccgagggtcccgacgtcacggcgacccccccgaggcta
ctgttcctcgagcccacccgccgcgcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccga
agaggagctggacgggtacgagccggaacctttggggaagcggccggctgtcctgcctttgctggagttggtcggggagg
ccagcggtggcccttgtacggacggctcactgccctcgacgccacccccagcagaggaggaggaagacgagttgtaccgg
cagtcgctggagattatctctcggtaccttcgggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctgg
ggcggccagccggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaag
gcatgcttcggaaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgac
ggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaacca
agaaggctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaa
gaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgca
ggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1L3M8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1041 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
gggggnatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccggtg
cggtgattggcggaagcgccggcgctagtcccccggccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntggc
gccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaaga
gatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctttggggaagc
ggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactgccctcgacg
ccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggc
aacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctccgacgggtcg
gggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaagacgatgtc
aaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttt
tggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgcatcgaaccattagcagaaagcatcacagatg
ttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggac
ctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataag
a
>gnl|bcl2dbcds|A0A3Q0RA11_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=810 residues).
atgaacacgtgtactatgaggaattgtcgaatgggctcgtataaaaatgtcatggacctttttcttcctcaaaatggagt
cgtggacggaacaatgcactatggatcggggaattcctctccgcaagatgccacaggtacacctaaagactccaatggta
ccccaaaacggccgaacaacctgggggtggtatcaacaaacggatatgcaccaaaaaatatcacggacgacgtggaagac
ggttcgttgccgagcaccccggagtttcattcggatagtgaatccgacgaggcgctggagagggaaacgaaaagcctcat
tactagtttctttagagactttactggactttctcaacgacgatggaaagaaagcgaagcactaaaaacaatgaaaagag
ttgtggcggacgtattagaaaagcaccgatacgcatacaacggaatggtcaacaaattgtcattggatgaaagaggggag
gacgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtattgccagtctgat
ggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagggacaattgtgtggagctggtgagccaggagattt
ccacatacctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggatttgtggagttttttcgtgta
gcagaccccgagtcaacagtgaggaacacactcatggcctttgctggatttgctggtattggggcaacactggccctgtt
gatcaggtga
>gnl|bcl2dbcds|A0A3Q0RA11_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=684 residues).
tctcttccttttacatccccagactccaatggtaccccaaaacggccgaacaacctgggggtggtatcaacaaacggata
tgcaccaaaaaatatcacggacgacgtggaagacggttcgttgccgagcaccccggagtttcattcggatagtgaatccg
acgaggcgctggagagggaaacgaaaagcctcattactagtttctttagagactttactggactttctcaacgacgatgg
aaagaaagcgaagcactaaaaacaatgaaaagagttgtggcggacgtattagaaaagcaccgatacgcatacaacggaat
ggtcaacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagcgcggtagccaagagcctgtttgcagaca
aaaccaccaactggggtcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagg
gacaattgtgtggagctggtgagccaggagatttccacatacctgctgtctgaccaacgagactggctggttaaaaacaa
tgcatgggatggatttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacacactcatggcctttgctg
gatttgctggtattggggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q0RA11_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=429 residues).
atgcctgagagaaatggtagtgctatatcaactcagttgggattacatcctaggatttctggaatggtcaacaaattgtc
attggatgaaagaggggaggacgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactggg
gtcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagggacaattgtgtggag
ctggtgagccaggagatttccacatacctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggatt
tgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacacactcatggcctttgctggatttgctggtattg
gggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q1BKL8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=MCL-1 (length=915 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccaatgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtcaaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcagtggtcttgctgctgtaggactaacacagagcactgaaa
actcttgcaaggatgcacacataagttgttgcaga
>gnl|bcl2dbcds|A0A3Q1BKL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccaatgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtcaaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3P8RQX7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion percula GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccagtgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtccaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3P8RQX7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion percula GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccagtgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtccaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=867 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagtgctgtccgacttcagcctcttcacctgcattaa
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=852 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagctcctgtagtgtgatgtga
>gnl|bcl2dbcds|R4GAJ0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=936 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctggcacaactgtgtctga
>gnl|bcl2dbcds|R4GAJ0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=990 residues).
atggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataacgacggcgg
cggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcgcgccggac
ccctgagggcgctgattggcccctgggaggggtctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaa
ccaaaatggcgcccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgc
gacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaaggagagaaagggaaaggagggccccctc
tcttcccggaccacctgcggaagacgacgctggaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtcc
aaaggcaccgggcccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcg
cgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctgctggccttccaaggaatgcttagaaagt
tggaaataaagaaagaagaggacttggcgtctgtggcagaagtgacaacagaggtcttcagagatggcataataaactgg
ggccgcattgtgactctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaa
cactttaatagaaattatcactgatgtgctggtgacggacaagagagaatggctattgaaacataatgcctgggagggat
ttgttcagttcttccatgtagaggacatagaaggtggcatcaggaatgttctggtggcttttgccagtgtggctggaata
ggggcaggcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A2K5C7L5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=717 residues).
atgtttggcctccaaagaaacgcgctaatcggactcaacctctactgtgagtgggccggcttggggactggcagtggcgg
caccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgtggtgattggcggaagcgccggcgctagcccctcggccgccctcacgcctgacgcccgggggtcgtgcggccgctgc
tggttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgcccga
agaagagctggacaggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtggaggagc
ctggtaatgactccagtacggatgggtcactaccctcgacgccgccgacatcactggagattatctctcggtaccttcgg
gaacaggcgactggcgccaaggacacaaagccaatggacaggtccggggccgccagcaggaaggctctggagaccttacg
acgggttggggacggcgtgcagcgcaaccacgagacggccttccaagttcttccatgtagaagacctagaaggtggcatc
agaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttgtaa
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=789 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=1059 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcact
gtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=600 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcactgtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5DMS4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=492 residues).
atgtttggcttccaagtggtaatcagactcaacctctactgcggtgccatccctccaggaccgcggcttttggcgactgg
cgccaaggacacaaagccaatgggcaggtctgaggccgccaacagtaaggcgctggagaccttacgaggggttggggaag
gcgtgccccgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaaaaacgaagacaatgtcaaatct
ttctacggcgtaacaaactggggtaggattgtgactctcagttcttttggtgcctttgtggccaaacacttgaagaccat
aaaccaagaaagttgcatcgaaccattagcagaaagtatcagatattctcgctgggatgggtttgtggagttcttccgtg
tagaggacttagaaggtggcatcagaaatgggctgctggctttcgcaggtgttgctggagtaggaactgatttggcatat
ctaataagatag
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=399 residues).
agccagagttataataacttaaagataaccacatgcatgcttcgaaaactggacatcaaaaacaaagacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttcttttggtg
cctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagacgttctc
gtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctaga
aggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=405 residues).
aatgcctcatgttccagacctgcatgcttttcttccccaggcatgcttcgaaaactggacatcaaaaacaaagacgatgt
caaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttctt
ttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagac
gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataa
gatag
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=834 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagatcttctacaatcttttga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
>gnl|bcl2dbcds|A0A3B1IEV7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=729 residues).
atgaacccaaccgcgatcagcctcctgtgtgacggaacaagcccggttctctacagaaccgagaaagaggagaagctgcc
ccggacggagcggccggaacgcggcctggaggggctgcagtccgctaaaggagtctccatgggcggcgggtctctgcccg
actccccgctggcggacgtagacttcatccaggactttagctgccgctgcccgggcgcgctggaggcggagacccgccgc
ctgatggtggagttttaccgcgggtacctgggccagaagccccgggagcagagcccggccctgcggaccatgagccgggt
ggtggcgggggtcgtcctcaaacacgggatcgcctacaacggtatggtccagaagctgaatttggaggagcaggacgaca
gtatggacattattagcagcgtagctaaggctctgtttagcgacggaaccacgaactgggggcggatcgttagcctggtg
gcgttcggcgcggtggtgtgtgatcatctgaagaagaagagtcgagatcactgcgtggagaacgtcgcccaacacatctc
cacctacctcaacacccaccaacaccagtggctcatcaacaacaacgcctgggacggattcgtggaattcttccgcgagg
acgactcagaatcacgagtccgaaacgccctgatggccttcgctggatttgccgggctgggggcggggctagcactactg
atgcgctga
>gnl|bcl2dbcds|A0A3B1K5R1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=735 residues).
atgatgagcccacaggatatgtgttcgtataacaagaagacggccgacattgttccccgggtcgctgttcgcggaggagg
gggaggagcggggctctcgctcggtctcgcggccgacattagacctaccaggcccggcgtcgacgacggctcagtgccca
gctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgctggacggagacacgcgagag
attatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggttgtacagacaatgaa
gcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggtatgttgaacaaactgggtatggaagacagag
gagatgacatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaactggggcagggtcgccagc
ctggtggcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaaga
actatcctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtggagttttttc
gtgttcctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcctcaatagca
tttttggcaagataa
>gnl|bcl2dbcds|A5PJR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F1MQX4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=573 residues).
ggaatgttgccaatattttcagaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccg
ggagcaggcaaccggcgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
accgagtcggggatggggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaa
gacgatgttaaatctttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|J7H260_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bufo japonicus formosus GN=MCL-1 (length=639 residues).
atgggcggctctctgccctccccgcagtccgagctggacgaggacgaggattacatggacgtacagtcggactcccgggg
ctccacctcccctccgctcacccccacctgctccccggaccccctgcacacggaaacccgcgccctgctgcacaccttct
tcagggaatgggccggagacgcgaagcaggaggacggcgacagcccgaaggcgctgcccaccatgcgcaggctggggggc
gacatcaatgagaagcaccgaatggcctttcagggcatgttgcagaagttatctatacaacgtccagaagatatccagaa
gctctccgaggtcccctctatggtcttcagcgatggggttaccaattggggccgtatcgtcaccgtgataagctttggtg
cgtttgtggctaaacatttgaaaagcatccacatggagaactgcgttggaatcctagcggacagcttcacagactatctt
atgacccagaagaaagaatggatcgtagaacacaatggctgggatggctgtgtcgaattctttcacgtcgaggactatga
gagtggactaaaaacagtcttgatggccttcgctggtgtggctggtcttggagcaagcctggcgtacatgatccggtga
>gnl|bcl2dbcds|F7GTF7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=594 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgg
agtaggagctgggttggcatatctaataagatag
>gnl|bcl2dbcds|F7GTF7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=813 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctgggttggcatatctaataa
gatagccttggaa
>gnl|bcl2dbcds|F7GTF7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=1053 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctgggttggcata
tctaataagatag
>gnl|bcl2dbcds|J9PBC4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1404 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatggaggggtgtggggggagtgg
tccaccccctctgaccttaagggtgagagcaggaaggaatgctgcccttcctgggccgctgaggctggaaggtggggggc
tgacctcagcctccagaccgtggctcagtggctcagtcccctcctgtcagcctgcaggaactcctcagctcctccctcct
ccccactagggattgtttacaggacagcttgggccacacagcacacgctcttcctgaagatgattctgatctggtttgcc
ctcctccctcccagaggaccccgatggccgagggaggcatgggtgacaacatgtgggacacccactccaaggagtggacc
agaagccccatgggagttcctttccctacctgccacccagctctttctcccatttttaacgaagctccttctggaacact
caggcatctctgccggactcaaacactttgtagccaagagataa
>gnl|bcl2dbcds|J9PBC4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q8HYS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtaatccggactcaactctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggagggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
agcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A452GAH0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1008 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcgcgccggcccgagccccccggccactcttg
cgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgtcaccgcgacccccaccagactg
ctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgcccga
agaggagctggacgggtgcgagccagaccctctcgggaagcggcctgccgtccggcctttagctttgatggtcggagaag
ccagtaacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatcagaggaggaggaggacgagttatat
cggcagtccctggagattatctctcagtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtc
tggggccaccagccggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttcc
aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatggttcatgttttcagt
gacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaa
tcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaac
aaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttt
gcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A452GAH0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcct
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A286Y1M5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cavia porcellus GN=MCL-1 (length=702 residues).
atgtcgcctgaggaggagctggacgggtacgagccggagcccctcgggaagcggccggccgtgctgcccttgctggggct
ggtgggggaggccgggaagagccccagcgccgacggttcgctgccctcgacgccgcccccggcggaggaggaggaggagg
aggacgcgctgtaccgacagtcgctggagatcatctcgcggtacctgcgggagcaggccgcgggcgccaaggactcgaag
ccgctgggcggggtggggcccaccagcaggaaggcactggagaccctgcggcgggtcggggacggcgtgcagcgcaacca
ccagaccgccttccaaggaatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatccttgtcgcgagtggttg
cccttgttttcagtgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacac
ttgaagagcataaaccaagaaagctgcatcgaaccattagcggaaagtatcacagatgctctggtgcactcaaaaaggga
ctggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatatagaggatctagaaggcggcatcagaaatg
tgctgctggcttttgcaggtgttgctggagtaggggctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A0D9RZP5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggctcggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgctggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgagcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5I9Q7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagaggacct
agaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaatcagat
agccttactgtaa
>gnl|bcl2dbcds|A0A2K5I9Q7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=1050 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac
gatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagtatca
cagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgta
gaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
aatcagatag
>gnl|bcl2dbcds|A0A2K5I9Q7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaatcagatag
>gnl|bcl2dbcds|A0A3P8V8T6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=582 residues).
ctggatatggtgctcataagcagtgtctgtttgacgctgtgcacactggaaaatgacaccaggcaattgatttgcgattt
cctgaaagacttcaccacaaaatctacccaacgattggtggagagcaaagcattgtcaactatgaaaagagtggtaaaag
gcattttagacaaacacagacatgcattcagtggcatgatcaacaacctctcttttgaaaacggagtatataatattgga
gttgttggggcagtggccaggagcctcttcagagatggcacctccaactggggtcgaatagttagcctggttgcatttgg
ggcagtgctttgtcagcacctaaaggagaaaggctgggagaacacggtggaccaggttggacaggagatcgcctcatacc
tgttgtcttatcagaaagactggctcctgaaaaacaactcctgggatggcttcgtggaattcttccaaggacaagagcca
gagaaggcaattagatgtacacttcttggctttgttgggtttgcaggactttgggcaacacttgccttactgatgagata
ttttctcaggtttgtgtggtag
>gnl|bcl2dbcds|A0A3P8VKS9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=858 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcaggtcaagaaaatga
>gnl|bcl2dbcds|A0A3P8VKS9_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=855 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagatggaaatga
>gnl|bcl2dbcds|A0A3P8VKS9_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=849 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagataa
>gnl|bcl2dbcds|A0A3P8VKS9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=849 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3P8VKS9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=915 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagggatttcaactccattggaaaagccttcacagtgg
ccttcgatgccatgttcctcttcattcgtcgctga
>gnl|bcl2dbcds|A0A3Q2EDX8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=MCL-1 (length=795 residues).
atgagttaccttattcttccacaaaatggagtcgtggacggacaaacgcactacagcccggagattgcagcaccagaaat
accaatgaactccccaatgggatctcttcaccgaaacttaatgaaacgtccgaaggatctgcaagtagcaacgaatggat
acgttggaaaaaacctttcagacaacagcgcagacgacggcgggtctctgccgtgcaccccggagatgccaacggacagc
caccccgccacaccgggcggccatgcgggggacgaagcgctggacaacgacacgaaggagcttattagcagtttcctaag
agactttacgggacttcctaaacaacggcggaatcaaactaaagctctgtctaccatgaaaagggtggtggaggacgttt
tgtcgaaacacagatacgcttacaatggtatgatgaataagctttgtttagatgaagtaccggacaacatgggatttgtg
agttcagtcgccacgagcctcttttcagacggaaccacgaattggggccggatagtgagcctggtggccttcggggctgt
ggtgtgtcagcacctgaaggagaaaggcagagagaactgcgtggagctggtgagccaagagatctccacatacctgctgc
aaaatcagagggactggctagtaaagaacaattcatggaatggatttgtggagttcttcagagtagaagatcctgaagca
acaatgaggaacactctcatggcttttgttggagtggctggtattggggcaacattggcctttctgatcaggtga
>gnl|bcl2dbcds|F8W4Q8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|F8W4Q8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=390 residues).
atgattctctggactctttcaggtatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagca
agtggcaacagagctctttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgt
gcaaataccagaatgacagaggacatagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagag
cagcgggactggatactcagaaacaaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgt
gagaaacacacttctaacaattggtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q1L8X3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacattgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtctgttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|Q568V1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=732 residues).
atgagcttcctcgcgcagggcgttcaaactccgacgctgaagacgtgcgtcgaagacgaactggacgggtacattgagga
ggaggaggcgcctctgaagcggcttagacctggtacaaacggcctgaaggggctgcagctggacggtcgatttgtttcta
cgacagacggatctctaccgaccaccccagatccagaggagctcgactacgccgaactggaacgcgatactcggcagctc
ttattggatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
ggtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagctggactctcagccgg
cctctctggacttcatcagatgtatagcaagcaccatgtttaaagatggcgtcactaactggggccgaatcgcgagtctg
gtggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatcagtgtgtggagagagtggctgagcagat
ctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctgtcatgggttcgtggagtttttccacc
aggaggacgtagagtctgttgtccgtcatggtctgttggcgctggtcggatgtgccggtatcggcgccggtctggccttc
ctcatccggtga
>gnl|bcl2dbcds|Q568W5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaataatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q8UWD6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtagtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q9I9N3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacactgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggtttgtggagtttttccaccaggaggatgtagagtctgttgtccgtcatggtcttttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|F7AVA6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=864 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
cacccttatggcctttgcaggagttgctggaattggggcaacacttgccctgttaatcaggtga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=822 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcaccgattgg
actattcctgcaagttttctga
>gnl|bcl2dbcds|M3XAP4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|M3XAP4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|M3XAP4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=813 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttttaa
>gnl|bcl2dbcds|Q7YRZ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|U3KKY6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ficedula albicollis GN=MCL-1 (length=273 residues).
aaaaaaaataaaaaaaatctcccaggaatgctccgaaaactggaaatccagcaagaagaggacctgcagtcggtggtgga
ggtggctgcccacgtgttcagcgatggggtgaccaactggggacgtgtggtgaccctcattgcctttggagccttcgtgg
ccaagcacctgaagagcatcaagcaggagcagagcatcacttccctggctgggatcatcacagatgcactggtgtcctcc
aaacgccagtggctggagagccaggggggctgg
>gnl|bcl2dbcds|A0A3Q2T2A9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Fundulus heteroclitus GN=MCL-1 (length=819 residues).
atgtctaaggcaccgacaagcacacaactggtaaactgtctaatttctcaaaatggagtcggggacggacaaccgcacta
caggccggggcttcaactgcccgaggttgaaatgagctcctcatcggaagatctccgctgggactgttcgaaacggccga
agaacctgcgagtgatggcgaggaacggcttcgcggtgaaaagcatccaggagaaccgcgacgacggctccctgcccagc
accccggagatgcaggcggacagcgaggccgccggctgcgggagccacgccggccaggaggcgctggacagcgacaccac
ggagcttattagcggtttcctcagagactttactggactgtcgggccatcggtggtacacgaaaaaatctctgtctacca
tgaagagggtggtggaggatctgttgtcgaagcacagatacgcttacaccggtatgatcaggaagctcaacctggatcag
aagtcagacgacatggggttcgtgacatcggttgcggtcagccttttctcggacggaaccaccaactggggtcgtatcgc
cagcctggtggccttcggggcggtgctgtgccagcacctgaaggagagcggccggtctcactgcgtggacctggtgagcc
gggagatctccacatacctgctgaccaaccagcgggactggctagccaagaacaactcatgggacggctttgtggagttc
tttaaagtagaggacacagagtcgacggtgaggaacacgctcatggcgttcgttggggtcgctgggattggggcaggatt
ggcctttcttatcaggtga
>gnl|bcl2dbcds|A0A3Q2T2A9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Fundulus heteroclitus GN=MCL-1 (length=894 residues).
atgtctaaggcaccgacaagcacacaactggtaaactgtctaatttctcaaaatggagtcggggacggacaaccgcacta
caggccggggcttcaactgcccgaggttgaaatgagctcctcatcggaagatctccgctgggactgttcgaaacggccga
agaacctgcgagtgatggcgaggaacggcttcgcggtgaaaagcatccaggagaaccgcgacgacggctccctgcccagc
accccggagatgcaggcggacagcgaggccgccggctgcgggagccacgccggccaggaggcgctggacagcgacaccac
ggagcttattagcggtttcctcagagactttactggactgtcgggccatcggtggtacacgaaaaaatctctgtctacca
tgaagagggtggtggaggatctgttgtcgaagcacagatacgcttacaccggtatgatcaggaagctcaacctggatcag
aagtcagacgacatggggttcgtgacatcggttgcggtcagccttttctcggacggaaccaccaactggggtcgtatcgc
cagcctggtggccttcggggcggtgctgtgccagcacctgaaggagagcggccggtctcactgcgtggacctggtgagcc
gggagatctccacatacctgctgaccaaccagcgggactggctagccaagaacaactcatgggacggctttgtggagttc
tttaaagtagaggacacagagtcgacggtgaggaacacgctcatggcgttcgttggggtcgctgggattggggcaggatt
ggcctttcttatcagaaatagtatcaaaatcagctttattggacaagattgttcctgggcattcacatctcctccgacct
ttcctggactgtga
>gnl|bcl2dbcds|D2ITA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|D2ITA0_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=1008 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccgaaagtggaggagttga
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=996 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|G3PJT0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=MCL-1 (length=957 residues).
atgaatataattcagagaccgaaactggccgcgttaaacatgaccggagtcatgagctgcattattctccctcaaaatgg
agtcgcgcccatgcgacagctcgcaatgggctcggcgaaggactcccacaacggcaacgcggggacaaacgacaccccga
agcggcccagcgccctcggggtgaactccgcgaacggctacccatcaaaaccgcagcgggaggacagcgaggacaccgac
aacgactcgctgccgtgcaccccggagtcggacagcgaaaccgacgtctccgactccccggcgggggccgcggctctgga
gagcgacacgaggcaactcctcggccgcttcctgagagaatttacgggactgtcgaaaacccagtggaacccgagcaggg
agctcaccaccatgaagagggtggtgggcgacgttttggagaagcacagatacgtattcaatggtatggtgaacaaattg
tcactggacgaccgaggcgacgacgccagtttcgtgcgggaggtcgccacgagcctcttcgcggacggcaccacgaactg
gggccgcatcgccagcctggtggccttcggggcggtggtgtgccaacacctggcggagcgaggccgggggaactgcgtgg
agctggtggggcaggagatctcggcctacctgctgtcggaccagcgggactggctgatcaaaaacaacgcctgggttggc
ttcgttgagttctttcgagtagcagacccagagtctgcggtgaggaacactctcatggctgtggctggattcgctagtat
tggggcgacactggccctgttgatcagtggaccttcaaaagtgcaaaggcagcttctcaccattgaattgttgcagatcg
tgcgctctcagaggggaggacaccggctgcagcgtgatgtgagcaccagaccttctccgacatccggctctggacta
>gnl|bcl2dbcds|A0A2I2YQH7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I2YQH7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I2YQH7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A3Q2VNL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Haplochromis burtoni GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacgtcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacgctcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
>gnl|bcl2dbcds|A0A3Q2XZL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hippocampus comes GN=MCL-1 (length=870 residues).
atgagtatggtgcagcccacaagccaagttctgaagccccaaggccgccccatgcgcccacaaaatggagtcgcggaagg
cttattgcaatgcaactctccccccgtcgccgccgcgtccacatcgccgccacagcttcatcgggccgtggcgaccttgg
gcgccgttaactgcaacagcggggccgccaagccccgacctagcgccttggaaattctctgcaagggcggactagccacc
atgaaccaccgcaacaacagcgacgacgacttcgatgtggaaagcagcgacgactcaccaccgagtacccccgactccca
ggactcactagtcgccgacggccgcaacgacgtggtggacgccgagaccaagggcctcattagacgttttctcacagact
ttaccggcctgtcgactgctagctggaacgaaagcaaggcacattcgaccatgaaaagagtcgtggctaaggttttggaa
aagcacaagtacaagtacaatggtatcatcaacaaattgtctctggacgaccgaggggacaacgtgagcttcatcagtga
agtagccaagagcctgttttcggatgggacaaccaactgggggcgcgtggccagcttggtggcctttggggccattgtgt
cccagcacctgaaagaaaagggccgggcccactgtgtggagccggtggccgatgagatctcttcgtatctgctgtcgcac
cagcgcaactggctggtgaaaaacaactcttgggatggctttgtacaattctttcgggaagtggatcctgagtctacagt
gaggaacacattaatggcctttgctggagtggctggcattggcgccacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q2Y539_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hippocampus comes GN=MCL-1 (length=714 residues).
atgccggagagtaaacgctttcccctgtataacttcaaggttggactcgtggacgctttaatgttgcctccaaaggctgt
cgttcaaggatccatggcctcgcagctgcaggaggtggaacgtcgttctgataacagcgacatggatgaaggcgcccagc
cgttgccggagctccaaacccctcccggccaaggcgtcttggacaccgagacgagacgtctcatcggccgcttcctccgt
gactttaccgggctgtccactgctgcttggatccaaagcaaagcccagtcgacaatgaagagggtcgtgacgagactggt
ggacaagcacaggatcttattcaataacatggtcaacgaactgtcactggaccaaagagggctcgacaggtcctttgtca
gccaggtggcccaaacggaattcgccaatgggaacattaactggggtcgcatcgccagcctgttggccttctgtgccgtg
ctgtctcaagccttgaaagaaaatcagcaggagaggtgcgtggaactggtggcccaggaggtctcgacctacttgctgtc
acaccagcgcacctggctagtgcagcacaacggttgggatggatttgcagaattcttcaaggaagacgacctggagtcta
cagtgaggaatggcctcttcgcctttgttggtttggtcagcgtcactgcagcgctacgctgtctgattcgatga
>gnl|bcl2dbcds|B4DLY8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=717 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatgg
cgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgt
tgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcc
tttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgt
aaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaag
gtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|B4DU51_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=840 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagatggaagccccggccgctgacgccatcatgtcgcccgaagagg
agctggacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggt
aataacaccagtacggacgggtcactacccttgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtc
gctggagattatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcca
ccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatg
cttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgt
aacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
gctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggc
tgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgt
tgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|B4E3L8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacagcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|C8YZ26_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
agactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccaagtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaaaaagatag
>gnl|bcl2dbcds|Q07820_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|Q07820_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|Q07820_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|B4DG83_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|A0A287DCH9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=852 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgaggtccccgacgtcaccgcgac
cccggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgt
cgcccgaagaggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgtt
ggagaggccgccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagct
gtaccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtg
ggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggcc
ttccaaggcatgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgtttt
cagtgacggagtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagca
taaaccaagaaagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtc
aaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
tttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A287DCH9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=1002 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcggcgc
caccccgccgggagcgcagctcttagccgccgagaaggaggccgcggcccggcgagaggcagggggaggggaagccgccc
agccgcccagcgcccgcagggtcgcgcggccggtgcccattggcgccgaggtccccgacgtcaccgcgaccccggcgagg
cgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgtcgcccgaaga
ggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgttggagaggccg
ccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagctgtaccggcag
tcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtgggtcgggggc
cgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggccttccaaggca
tgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacgga
gtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaaga
aagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtcaaacaaagag
gctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttcgcaggt
gttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A3Q3B4V7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=819 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagtgtttgttggccttga
>gnl|bcl2dbcds|A0A3Q3B4V7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=1047 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagcacttggtcagcaaaatgtgagcacaggcctctggaaaatgaatcatgtgtatctctggcgcctgggatcagaagtt
gctacctaagcacaaccacacatttaagttgggcagcagaaatctgggctgcaggtgtggatcaacaggatgagtcaaac
cttaatattgggtggatcctgcctcttcacaatgactgctggagacaggcaccagctccctgcgtctctgcagggaaaag
ggagtaa
>gnl|bcl2dbcds|A0A3Q3GP42_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Labrus bergylta GN=MCL-1 (length=825 residues).
atggatatcattaatatgaagcgggcggcggtcagcgtatctgccggagtcatgagctttatgatgccacaaaatggagt
cgggaagggacagatgcactacggcccggaagcgtcctctccacaaatagcgatgggatcctctttagcctcacaaaatg
ggaatgtcgggtcgaatgaaaccaccaagcggcccaaggctctggttgttaactcgggaaacgacgatatcgaagacggc
tcgctgccgtgcaccccggagccggacagtgaaaccgaagtctccagctgtcccactgggggcgaagtcctggagagcga
caccaggcaactcatcagcgccttcctcagagagcatactgggctttcaaagcctggttggaatgagagtagtgcactat
cgacgatgaaaagagtcgtggaggacgtgctggcgaaacacagatacgcgtataatggtatgatcaacaaactgtcactg
gaagacagaggggacgatgcaagttttgtcagcgctgtggcaaagagcctttttgcggatggaacaacaaactggggcag
gatcgccagcctggtcgcttttggagcggctgtgtcacaatacctgaaggagaatggcagggggcactgtgtggagctgg
tggggcaggagatctccacgtacctgctgtctgaccaccgggactggctggtcaaaaacaacgcctgggacggctttgtc
gagttctttcgagtagcagacccagagtccacagtgaggacaacactcatggcttttgctgggttcgcaggaattggggc
cacgttggccctgttgatcaggtga
>gnl|bcl2dbcds|H3AR18_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=591 residues).
atggaattaccgggggacgggtgcccgcaggacggggacatggcggagtttcgcaaggagacgctgaagctgttgcggag
ttacttgtgcgaggtggcgggctgcgagagcacggagacggccttcaggttcggtctagatcagtggagcggtggcgaga
agccgctggacaccctccggcgggtcggggatagcatcatagacaaacaccgcatcgcctttaatggaatgcaacaaaag
ctaaacatccataaggaggacgacctccacattatacccgaaattggtaaccagatctttaaggacggtgcaacaaactg
gggtcgcattgttagtcttattgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctggaagacagcattg
aacagttggcagtgtcgatcacagactttctggtgcagaataagggagactggatcctcaagaaccaaggctggaaagga
tttgttgactttttccatgtagaagatgcagagggtacaatcaaaaatgtattgatgacatttgcgggcgttgctggact
gggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|H3AR18_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=624 residues).
ggttacaacgccgacggctccgtgccgccttcgccgcccaccccgtcgacccccgaggacggggacggggacatggcgga
gtttcgcaaggagacgctgaagctgttgcggagttacttgtgcgaggtggcgggctgcgagagcacggagacggccttca
ggttcggtctagatcagtggagcggtggcgagaagccgctggacaccctccggcgggtcggggatagcatcatagacaaa
caccgcatcgcctttaatggaatgcaacaaaagctaaacatccataaggaggacgacctccacattatacccgaaattgg
taaccagatctttaaggacggtgcaacaaactggggtcgcattgttagtcttattgcttttggagcagtcgttgccaaga
agctcaaaaagatgaacctggaagacagcattgaacagttggcagtgtcgatcacagactttctggtgcagaataaggga
gactggatcctcaagaaccaaggctggaaaggatttgttgactttttccatgtagaagatgcagagggtacaatcaaaaa
tgtattgatgacatttgcgggcgttgctggactgggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|W5MMB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=MCL-1 (length=882 residues).
atgagcctctcctcgctgaagcgcacctcggccagcgccgtgatacagctctattgccccaacgccaccaccattcaccc
cggcctcgccagcctggggccctgtccgggcgggtccgccgcccgcacggctgtcctggaccccatgctcaaggcggact
acgccgaggacgaactggacaactactcggcggagcccgtggcgaccagcgcctggatccccaagtcgccgcggtcgctg
cccgcggggctgaagctgggcggccacttcccggagagcggccacgccgacgggtccctgccctccaccccggacacccc
gctggactgcggcagcgtccccgagttcctctccgaggcccacgggcagctgaacgcggagacccgggagttaatcggga
cctttttgcagatgtacacggggttgccgcaccgccggagccgaggcaaggccctggagaccctgaagcgcgtcgtggac
agtgtggtggcgaagcatcagatcgcctaccacggcatgatcgcgaagctggagctggagaacaagggtgaggacgtgag
cttcgtgacgggcgtggccaaaagcttgttcagcgacgggaagaccaactggggccgcatcgccagcctggtgtcgttcg
gcgcggtggtggccaagcagatgaaggactcgggccgggagagctgcgtggaggcggtgggccaggcgatctccaactac
ctactgcaggaccagcgcgagtggcttctgaacaaccgaggctgggacggcttcgtggagttcttccgcgtggaggaccc
cgagtcgacgatcaggaacgccctgatggcgtttgccggggtggcggggctgggcgcggggctggccctgctgatcagat
ga
>gnl|bcl2dbcds|G3T756_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Loxodonta africana GN=MCL-1 (length=1026 residues).
atgttcggcttcaagagaaacgcagtaatcggactcaacctttactgtgggggggccggcttgggggccggcggctgcgc
cacccctccgggagggcgacttccagctcctggaaaggaggccacggcccggcaagaggtagggggaggggacgccggcg
cgagccccccggccgctgtcgctccggacggccggagggtcgtgcggccggcgcccattggcgccgagggccccgacgtc
actgcgattcccgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtggagatggaggctctagccgc
cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagccgctcgggaagcggccggctgtttttcccc
ggctggggctggtcggggaggccagtaatggccccggtaccgacgggtcactaccctcgacgccgcccctagcagaggag
gaggaggacgagttgtaccggcagtcgctagagattatctctcggtaccttcaggagcaggcaaccggcgccaaggacac
caagccaatgggcgggtctggggcggccagcaggaaggcgttagagaccctccggcgagtcgcggacggggtgcagcgca
accacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaagatgatgtcaaatctttatctcgagta
atggcccatgttttcagtgacgggataacaaactggggcagaattgtgactctcatatcttttggtgcctttgtggccaa
acacttgaagagcgtaaaccaagaaagccgcatcgaaccattagcagaaagtatcacagatgttctcgtaaggacgaaaa
gggactggttagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaga
aatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5W0W9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5W0W9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5W0W9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|I7G687_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcagcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgtttttagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F7HUE9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcgtcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F7HUE9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6ECR0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6ECR0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6ECR0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A3Q3M6G2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=852 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagttactgtggtgtaatgtga
>gnl|bcl2dbcds|A0A3Q3M6G2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=891 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagcagaaataataaaatgctgacttctcaaagtgccatcagcgcgcctg
tctcagcatag
>gnl|bcl2dbcds|A0A3P9BVM3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Maylandia zebra GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgtaccctaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatctggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccagagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcttttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaattacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|G1MPY7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Meleagris gallopavo GN=MCL-1 (length=369 residues).
ttttcaggaatgcttcggaagctggaaatcaaaaaagaagaagatctgcaggcggtgtgtgaggtggctgctcacgtttt
cagtgatggagtaacaaactggggccgagttgtcacactcatctcatttggtgccttcgttgcaaaacacctgaaaagca
tcaaccaagagaaatgcatcagctcgctggcggggatcatcacagacgctttggtctcatccaagcgcgagtggctgatg
agccagggaggctgggagggctttgtcgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggc
ctttgcaggagtggccggcctgggggcgagcttggcctacatgatccgg
>gnl|bcl2dbcds|A0A3Q3VP02_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mola mola GN=MCL-1 (length=789 residues).
atgaacgtgttgtttcaaaatggagtcgtgtcgggaccgacgcgttcctcgcaaatcgggatgggctcctgtctagactc
tcacaacggtaatgtcgctttaaacgatacctccaaacggcctaatttactagtagtgaacccaacgaaggaatatatgg
gaaaacccatccgaaaagacagcaccgacaccgacgacgacggttcgctgccgtacacgccggatatgtccccggacagt
gaactcaacgtctccggttgtttggcgggggatgaactgttggagaaggacacgaggcagctcattagccgcgtcttgat
ggaactttctggacacggaagagcacgatggactgaaagcagaacactatcaacgatgaaaagagtcgtggccgagcttt
tggaaaaacacagatacgtatacaatggtatgacaaaaagactgtcattggctgacacacaggacaatgtgagttttgtc
agcactgtatccagagatctgttttcagatggagcaacgaactggggccgtattgccagcctggttgcctttggggtcgt
ggtgtcccagtgcctgaaggagaacggcaagagtgaccgtgtggagctggtggctcatgagatctccacatacctgttga
cagaccagcgggactggatgtgtgtgggcggtgatggctttgtcgagttctttcgagtagcagacccagaatccacggtg
aggaacgcgctcatgaccattgctggagttgctggtattggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|F6ZMX1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1068 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctgggagggattt
gtggaattctttcatgtacaggacctagaaggtggcatcagaaatgtgctgctcgcctttgccggtgttgctggagtagg
agctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A3Q3IZW0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monopterus albus GN=MCL-1 (length=915 residues).
atgaacatcattacctcgaagaagtgggcagacgttaacgttacaaccgaaatcatgagccttattcttcctcaaaatgg
agtcgtggagggatccatgcactgcggctcaaatacctcaccacagtttgccgtaggatcttcaatagactcttgtaaag
gcaatgttgggcccaataatactctgaaacggcccaagatcctggatgtcagctcaacaaatgggtatggaacaaaaacc
cttgtggatgtcagcgacattgacaacggctcattgccgtgtagtcctgtgctacagccggataatgaaattgaagtctc
cagttccccagcagagtacgaagtcctggagaatgacacgaggctactaatttgccacttccttagagattatactggac
tatctacacatcggtggacccgcagaaaaactctatcgacgatgaaaagagttgtggagggcgttttggaaaaacacaga
tacgcatacaaaggcatgatcaacaaactgtcactggacgagagaggggatgatatgagttttgtcggctcagtggccca
gagcatcttcgctgatgggaccaccaactgggggcggattaccagccttttggcctttggtgcagtggtgtgtcagtacc
tgaaggagaaaggcagggagaactgtgtggagttggtgggacaggagatctccacgtacctgctgtctcaccagcgggac
tggctggttaagaacaacgcttgggacggctttgaagaattttttcgagtagcagacccagagtctacagtgaggaccac
acttatggcctttgctggatttgctggtatcggggcaactctggccctgttgatcaggacaaacaacacttgtggaggcc
ttaagaggaaatggagtagagcctctccatggtga
>gnl|bcl2dbcds|P97287_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus musculus GN=MCL-1 (length=996 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctccggaggaggaact
ggacggctgcgagccggaggccatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctt
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
atgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
ggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|P97287_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus musculus GN=MCL-1 (length=858 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccgaggaccccgacgtcaccgcgtc
ggccgaaaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgcca
tcgtgtctccggaggaggaactggacggctgcgagccggaggccatcggcaagcgcccggccgtgctgcccctcctggag
cgcgtgagcgaggcggccaagagctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagagga
cgacctataccgccagtcgctggagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctc
tgggcgaggcgggcgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgag
acggccttccagggcatgctccggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtcca
tgttttcaaagatggcgtaacaaactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaa
agagcgtaaaccaagaaagcttcatcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactgg
cttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgct
gctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|M3XZZ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mustela putorius furo GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcaccggggg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacccaccgcgcgtcgcc
gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacgagccggaacctt
tggggaagaggcctgctgtcctgcctttgctggagttggtgggggaggccagcagtggcccctgcacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtctctggagattatttctcggtacctgcg
ggagcaggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtgcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G1PZ39_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=795 residues).
gccccgccctctcccattagcggccgagggccccgacgtcatcgggacccttcgcgcggcggctgtttgcgccccttggc
tgtgcggggctgcccgcggagatggaaagccgcggccgccgacgccatcatgtcgccggaagaggagctggacgggtacg
agccggagcctctcgggaagcggccggccgtcctgcccttggtgcagctggtcggggaggccagcggcggccccggcgcg
gggggctcgctgccctccacgccgccccccgcggaggaggaggaggacgagctgttccggcagtcgctggagatcatctc
tcggtaccgggagcaggcgaccggcgccaaggacgccaagcccctgggcgggcccgcggcctccagccggaaggcgctgg
agaccctgcggcgggtcggggacggcgtgcagcggaaccacgagatggccttccaaggtgagcgggggccgcgcgccctc
tgtcttgtccgcgatcgctgggctcccgtgggtggaaaccgagacgagcccgggctggaagggctctccgcccgtttccg
aaaccagcatattctggccatgagtcattgtttccgcccacccgattccttgggaaccgctctccgctcaaaggccggaa
aggtgtgggagacctccaacacttgccatggcttcaaggatgggtttgtggaattcttccatgtagaggacctagaaggc
ggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1QAV8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=975 residues).
atgtttggccccaaaagaaatgcattcatcggactcaacctccactgcgggggggcagttgggggcctgtggcggcagcg
aagcctacatctccttcaggaaggaggtccctgcccccaagagtcaggggcggggagggaaacgggcacggtgattggct
ggagcgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggcacggag
ggtcccgatggcaccgcggcccctgccaggtggctgttctcgcccatcagccggaattgccctgaagagctgggagctct
ggcagccgacgccatcatgtcgcccggagaggagctgggcaggtatgagccggagccgaagcagccggctgtcctgccct
tgctccagctggtcggggaggccagcgaaggccccgcaggtggctcactgccctcgaccccgccccctgctgaggaggag
gaggaattgtcactgctggagatgatccctcagcaccttagggaacgggctggcgccagggaccaaagccagggcccgcg
ggtcggcggggtgcagcggcgtgcagcagggtgcagcggggtgcggcaggagactgccttcctaggtatgcttgaactgg
acaccgaaaacgaagacaacgtcaaatcttcgtctcaagcgatggttcatgcttttagggacggagtgacaaacggcagg
attgtgactcatttcttttggtgcctttgtagccacttgaagagcataaaccaagaaagctgcattgaaccgttagcaga
agacatcacagatgttctcgtagggacagaacgaggctggctagtcaaacagagaggctgggatgggtttgtggaattct
tccaggtggaggacctagaaggcggcgtcagaaatgtgctgctggcttttgcaggtgctggagtaggagctggtttgcca
tatctaataaggtag
>gnl|bcl2dbcds|A0A3Q4HLQ8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neolamprologus brichardi GN=MCL-1 (length=819 residues).
atgaccaactatatgatgtcgaaaaggaaccagtgcaccttcatagactatcttattcctcaaaatggagtcctagaggg
accaatgcactatggatcgggaaattcctcaccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataccacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttcgcagcctcaacgaaaggaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtgttgt
cagctttgtggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactgcgtggcgctagttagcc
aagagatttctgcatacctgctgtctgagcagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=816 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=444 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
catgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=1053 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|I3JHR5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=837 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|I3KXG5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=507 residues).
ctggagagagaaactaaactcattattcacagttttttgggagactttactggactttctcagcctcaacgaaaggaaac
caaagcactaaaaatgatgaaaagagttgttgcggacgtattagaaaagcacagatatgcttacaacggaatgattaata
aattgtcattggatgaaagagaagaagatatgtcatttgtagcgaagagcctctttggagaccacacgaccaactggggt
cgtattgtcagctttgtggccttcggggcagtggtgtctcagcacctgaaggaaaagggcagggacaactgcgtggtgct
agtgagtcaagagatttctgcatacttgctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttg
tggcgttcgttcgagtagcagaccctgagtcgatagtcaggaacacactcatggcctttgctggatttgcttgtattggg
gcaacactggcactgttgatcaggtga
>gnl|bcl2dbcds|G1T2Q0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=999 residues).
atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtggcggcgg
cgtcgcccctccggcagagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagggggaggggaggccg
gcgcggtgattggcggaagcccgggcgctattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtac
ttggcgcccacccgccgcgcgtcgccgctcgaggagatggaagccccggctgcggacgccatcatgtcgcccgaagagga
gctggacggctacgagccggagccccttgcgaagcggccggccgtcctgcccctgctggacttggtgggggaggccagta
aggtccctagcacggacgggtcgctgccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcg
ctggagattatcgcccggtaccttcgggagcaggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgc
gagccggaaggcgctcgagaccctgcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgc
ttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgta
acaaactggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaag
ctgcatagaacctttagcggaaagtatcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggct
gggatgggtttgtggagttcttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgtt
gccggagtaggagcggggctggcttatctgataagatag
>gnl|bcl2dbcds|G1T2Q0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=1050 residues).
atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtggcggcgg
cgtcgcccctccggcagagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagggggaggggaggccg
gcgcggtgattggcggaagcccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcgcgcggccggcg
cccattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtacttggcgcccacccgccgcgcgtcgcc
gctcgaggagatggaagccccggctgcggacgccatcatgtcgcccgaagaggagctggacggctacgagccggagcccc
ttgcgaagcggccggccgtcctgcccctgctggacttggtgggggaggccagtaaggtccctagcacggacgggtcgctg
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatcgcccggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgcgagccggaaggcgctcgagaccctgc
ggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaactggggcaggattgtgactct
gatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatagaacctttagcggaaagta
tcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccggagtaggagcggggctggctta
tctgataaga
>gnl|bcl2dbcds|H2MLZ3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|H2MLZ3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=858 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaa
tatgatggccatttttaaaggacttcctgcttctaccagacttcacaactcgagatag
>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=813 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgtgtaggtga
>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=906 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgcaaggtccataccgtatttggcaggatatgacatcatgtcacactaatctatccaaaaataaagttggaagatcac
caagttttgctgttgaagggccgtaa
>gnl|bcl2dbcds|H0XFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggcgccgggctgggggctggcagcggcgg
cgccacacccccgggagggcggcttttggctgcggagaaggaggccgcggcccggcgagaggcagggggaggggaagccg
gcgaggtgattggcggaagccccggcgcgagttccccggcctccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggtgccgaagtccccgacgtcaccgcgacccccacgaggctgctgttcttcgcgcccaccctccgtgcggcgcc
gcgggaggagatggaagcccctgccgccgacgccatcatgtcgccggaagatgagctggacgggtacgagccggagcctt
tggggaagcggccggcggtcctgcctttgctggagttggtcggggaggccagtaacggccccagcactgatgggtcactt
ccttcgacaccgcccccagcagaggaggaggaggatgagttataccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggcgaccggtgccaaggacgcgaaaccaatgggcagggcaggagccgccagcaggaaggcgctggagaccttgc
gccgcgttggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|H0XHA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=582 residues).
ctaccagaccagatggaagcccaagttgccgatgccgtcaagtcgcccgaaggtgaggtggcctcgtgcgagccggagcc
tctcaagaagcaaccggagggcctgcctttgctggagtttgttggtgaggccggtaacggccccagcactgacacacttc
cttccacacctcccccagcagaggaggaggatgagttatactggcagtcgatggagatcatctctcggtacctatgggag
caggaaactggagaggatatcaactctttgtctcgagtgatggcccatgttttcagttacggcgtaacaaattggggcag
gattatgaccctaatttttggtggctttgtggccaagcacctgaagaccataaaccaagaaggctacatcaaaccgctag
aagaaaatatcgcagatgtccttgtgaggacaaaaccggactggctagtcaaacaacgaggctgggatggctttgtggag
ttcttctacctggaagacctggaaagcagcgtcagaaacgtgctgctggctttcgcaggtgttgctggagtaggagctgg
cttgacctatctaataagatag
>gnl|bcl2dbcds|W5QI41_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ovis aries GN=MCL-1 (length=807 residues).
gggagccggaaaccccgccctgccccaggccccgcccctgccttgaccccgccggttaggtgccgtgcgcaaccgccgga
agctttcgctgccttccccatttacgggatgcagataaagaggcagcagcagtggttcaagatgtttggcttcaagaggc
gccctgccgtccggcctttacctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcctggagca
agcaaccggcaccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgcagag
tcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttc
ttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacag
atgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccgtgtagag
gacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaat
aagatag
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G2HFR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=444 residues).
atggacatttgccggctctcagcagcaatgcgtgaattttacattgtgcatctggatatatacccaccacctgagtgtac
cattcacatgttactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|K7DE58_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=378 residues).
agtgttgaaacgtgcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatcca
tgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttga
agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactgg
ctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgct
gctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|K7DE58_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|K7DE58_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|K7DE58_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I3M3D6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaaccgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctcttggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3M3D6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3M3D6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaaccgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctcttggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A3B3R4U0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=MCL-1 (length=816 residues).
atgaatctgatcaatcgtaccacggccaccggcttgttctgccccggcattaaaaatggcgtgaagcagaacggcttcta
cagctttgtatcggcgtctctgcccgtagccccgctcaaagcgaaaagcgaagaggagctggacagtctggatgaaggcg
aacgttttcatggagcgccgaaaacagagaggcgtgattgcgaacaccacttacgggcgtcgggcaacgaagacgggtct
ttgccgtccacgccggggacgccgccggactgcgggaaaatgctgacgtttcccaacagggggctcagccaggagactca
tgagcttatcgggaccttcttacggacttacagcggcctcccggcctcggccagccgacacaaagcgtaccctgtcctca
gacgagtggcggagactgtcataggaaagcacttgatcgcgtacaatggcatgattaaaaaactagaactggataagcgt
ggggacgacacaagtttcgtcacgaaggtggccgaggaaatcttcagtgacaaggtcaccaactggggtcgcatcgccag
cctgatagcgtttgggggtgtcgtgtgcaagtacctgaaagatcacggacagaccaactgcgtggatgatgtggcaagcc
ggatcagctgctacctgctggaacaccagagggactggctaaaccgtaacaatggctgggagggatttacagacttcttc
tatatggaagacccagagtccactgtgcgtaatgctcttgtggcatttgcaggagttgcaagcctgggggctggacttgc
tctgttgatgaggtga
>gnl|bcl2dbcds|A0A3B3SG34_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=MCL-1 (length=888 residues).
atgaatccacaaagcttgaagagttacgcgccgattatggtgagcatgaactaccacagacccctgcaccatggcgtcct
ggggaaaagcattttgcagtgtctcgattcgtctgcaagagccgcaaacacaccctgtctggagtcctccgggttatggg
acgacgagctggacaactgtacggacgaggtggacgtgtgtccctgctcgacaagactcgccaaaagggattctgaaaaa
gagccgtgtcggggaagccggttgcccgggagcacaaacgcggtcggctcactgccgacttccccggacggcgacttgcc
agcttacggacccatttgtggtttctctcgcagcgccgtcgaaatgctggaccaagagactagcgaattaatcacgactt
tcttcgccgaatacacggggctgtgtgcgacattacagagacgaaacgaggcgctctccacactgaagcgggtggtggcg
actgttgtcgaaaaacacaagtttgcttacaatggtatgattggaaaactaagtttgaatcagcagagtgatgacatgac
cgtaatcaaaactgtagctgagagaatattcagtgatggaaccacaaactgggggcgtattgccagccttgtggcctttg
gggcagaggtgtgtaaatacctgaaggagactgggcgggagcactgcgtggaggctgtggggaagcagatctcctcctac
ctgctctcagagcagcgacaatggctactcaagaacaaggcctgggatggatttgtggagttctttcatgtagaagacac
tgaatcgttggtcctccagaaggttcttgtacatgtttctgagtgcggatcctttgaattacatgaccttaaagccttgt
gcatgtaa
>gnl|bcl2dbcds|K7FPN7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=MCL-1 (length=366 residues).
gggatgcttcggaaactagacatcaagaatgaggaggatctcaagtcagtgtcatcagttgcaacccatgttttcagtga
tggaataacaaactggggtagaattgtaacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaacc
aggagaattgcatcaacacgctagcagggatcatcacagatgtgcttgtctcagacaaacgagattggctagttaaccaa
agaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgc
aggctttgctggactgggtgcaagcttggcgtacatgatgcgatga
>gnl|bcl2dbcds|A0A3B4AFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=MCL-1 (length=741 residues).
gacaccacatgcctacagggtgtgctaactccaccgcttggcacagcccacatttgcggctctcctcatccacgacccac
agctcttgtaatgaaaaacgaacttttaaataagaacacgcgagaagaggattacgaaaactcagaggggtctctgccat
gtacgccagaattccactcagacagtgaaatggagctctccagctactcggcggagcacgaagtgttagagagcgacacg
aggcagcttcttagcgattttttcaagcttttcacggggatttctcagccgaagtggaaacaacgtccggccctatctac
aatgaagggagttgtggacaagcttttggaaaagcacagatacgcatataatggtatgataaacaaactggctctggacg
acaggggggacgacgtatcgtttattggcacagtagccaagagtatctttgaagatggtaccactaactggggtcgtatt
gccagccttatagcctttggggctgtggtgtgccagtacctcaagacaaaaggaagagaaagctgtgtggagcgagtggg
ccaagaaatttcctcatacctcctgttggaccaacgagactggctagtcaggaataatgcctgggatggctttgtcgact
tcttcagagtagaagacccagagtcagcagtgaggaacacgcttatggctgtagctggattagctggtattggtgcaacg
ctggccatgttgatcaggtga
>gnl|bcl2dbcds|A0A3B4AFB7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=MCL-1 (length=858 residues).
atgaatattattaattctccgaagaggaccgcgttaaaactgtccaccatgggcttgtttctgcctcaaaatggactcgc
ggagggggacatgcactgtggggctgcagattcttccgcgcagatgcctaggcctgcaactatggacactcgtaaaggga
atacggcctccagcggctctcctcatccacgacccacagctcttgtaatgaaaaacgaacttttaaataagaacacgcga
gaagaggattacgaaaactcagaggggtctctgccatgtacgccagaattccactcagacagtgaaatggagctctccag
ctactcggcggagcacgaagtgttagagagcgacacgaggcagcttcttagcgattttttcaagcttttcacggggattt
ctcagccgaagtggaaacaacgtccggccctatctacaatgaagggagttgtggacaagcttttggaaaagcacagatac
gcatataatggtatgataaacaaactggctctggacgacaggggggacgacgtatcgtttattggcacagtagccaagag
tatctttgaagatggtaccactaactggggtcgtattgccagccttatagcctttggggctgtggtgtgccagtacctca
agacaaaaggaagagaaagctgtgtggagcgagtgggccaagaaatttcctcatacctcctgttggaccaacgagactgg
ctagtcaggaataatgcctgggatggctttgtcgacttcttcagagtagaagacccagagtcagcagtgaggaacacgct
tatggctgtagctggattagctggtattggtgcaacgctggccatgttgatcaggtga
>gnl|bcl2dbcds|A0A087X830_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia formosa GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcattaaactatctaattttttctcaaaatggagtcggggatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccctacaagaaac
gcccgacgaatctcgcagtgtccgcatcgaatggatatgttgcaaaaagcctccagaagagcagcgacgacagcgacgaa
ggctctctgccatgcactccagcgcagcaagacagtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaatggagctcattagcagttttctaagaaattttacaggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcaacaggctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagaatctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgcagtgtgtcagcacctgaaggagaggggcagagagcattgcgtgg
agctggtgagcaaggaaatatccacgtatctcctggaaaaccagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagatcctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A3B3VM25_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia latipinna GN=MCL-1 (length=903 residues).
atgacggctaattcgacaaccgcgttaaactatctaattttttctcaaaatggagtcggggatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccctacaagcaac
gcccgacgaatctcgcagtgaccgcatcgaatggatatgttgcaaaaagcctccaggagagcagcgacgaaggctctctg
ccatgcactccagcgcagcaagacagtgaaaccgtcgcgtctgctgtacgtgcgagcaaccaagtgctggataacgacac
aatggagcttattggcagttttctaagaaattttacaggactttcaaagtgtcggtggagtcaaaataaagctctatcta
cgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcaacaggcttgctctggat
aaccagccggacaatatggggtttgttacggaagtagcacagaatctcttttcagacgggaccaccaactggggtcggat
cgtcagcctggtggcgttcggggctgcagtgtgtcagcacctgaaggaaaggggcagagagcattgcgtggagctggtga
tccaggaaatatccacgtatctcctggaaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtggag
ttctttagagtatcagatcctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtattggggcaac
attagcctttctcatcagaaagctacgatcagcgcttggtcagcaaaagctaaatacaagccttttggaaatgagagact
gcacaagtctggagccaggataa
>gnl|bcl2dbcds|A0A3B3YCD0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia mexicana GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcgttaaactatctaattttttctcaaaatggagtcggggatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccctacaagcaac
gcccgacgaatctcgcagtgaccgcatcgaatggatatgttgcaaaaagcctccagaagagcagcgacgacagcgacgaa
ggctctctgccatgcactccagcgcagcaagacagtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaatggagctcattagcagttttctaagacattttacaggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcaacaggctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagaatctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgcagtgtgtcagcacctgaaggagaggggcagagagcattgcgtgg
agctggtgagcaaggaaatatccacgtatctcctggaaaaccagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagatcctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A3P9Q4R7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia reticulata GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaatggagtcgggaatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatcccttcaagaaac
gcccgacgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccggagagcagcgacgacagcgacgaa
ggctctctgccatgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaacggagcttattagcagttttctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcagcaagctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagagtctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgtagtgtgtcagcacctgaaggagaggggcagagagcactgcgtgg
atctggtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagaccctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A3P9Q4R7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia reticulata GN=MCL-1 (length=834 residues).
atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaatggagtcgggaatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatcccttcaagaaac
gcccgacgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccggagagcagcgacgacagcgacgaa
ggctctctgccatgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaacggagcttattagcagttttctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcagcaagctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagagtctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgtagtgtgtcagcacctgaaggagaggggcagagagcactgcgtgg
atctggtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagaccctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcagcaagtaa
>gnl|bcl2dbcds|H2N5Y9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pongo abelii GN=MCL-1 (length=1053 residues).
atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggtgctggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtctaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccattgggcaggtctggggccacctgcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6F6N9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=411 residues).
gatctgtggattaacctggggatcagctgcgggcgggcagatctaggctgggcctggctgggtttgaaggccttccaagg
catgcttcagaaactggacatcaaaaacgaagacgatgtcaaatctttatcacgagtgatggtccatgttttcagtgaca
gcgtaacaaactggggcaggattgtgactttaatttctttttgtgcctttgtgtccaaacacttgaagaccataaaccaa
gagagctgcatcgaaccattagcagaaagtatcacagacattcttgtaaggacgaaacgagactggctattcttccatgt
agaagacctggaaggcagcatcagaaatgtgctgctggcttttgctggtgttgctggagtaggagctggtttgacttatc
taataagatag
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A3B4G4Z6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pundamilia nyererei GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacgctcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|A0A3B4C6H5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=735 residues).
atggtcaggctgttcggtgttgggttgagagtggtccactatgcaaaatatccaaagactgtttttccttctttgctggc
gaagcgaccttttactctgggtatatcctctcaaacccgggcgcccaggatcgcagctgttacagacggttctctaccaa
cgtcccccgcgtcggattgtgaggagttggactcagaccaattcaaggaatctgaaactttggacagagacacttcagaa
atagtcattgactttttgcaaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataag
gagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctgggtatggaagacagag
gagatgacatgcatataattaggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgccagc
ctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttgtgggccaaga
gatttcctcatatcttctttcagaccaaaaagactggctactgaaaaataaagcatgggatggctttgtggagttttttc
atgtcccggatcccgagtcaaaaatgaggaatgcattaatggccttggttactgcagcaggtgttggagcaggacttgtt
ttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4C6H5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=717 residues).
atgatgatgagtcccaaggagatgtattttgataagaagactgtttttccttctttgctggcgaagcgaccttttactct
gggtatatcctctcaaacccgggcgcccaggatcgcagctgttacagacggttctctaccaacgtcccccgcgtcggatt
gtgaggagttggactcagaccaattcaaggaatctgaaactttggacagagacacttcagaaatagtcattgactttttg
caaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataaggagggtggtggacggcct
ggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctgggtatggaagacagaggagatgacatgcatataa
ttaggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgccagcctgctggcctttggtgca
gtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttgtgggccaagagatttcctcatatcttct
ttcagaccaaaaagactggctactgaaaaataaagcatgggatggctttgtggagttttttcatgtcccggatcccgagt
caaaaatgaggaatgcattaatggccttggttactgcagcaggtgttggagcaggacttgttttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4C6H5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=669 residues).
ttattttcatttgtgtgggaattttctaggaaatggccatggaattttctttgggaaaaactgatcgcagctgttacaga
cggttctctaccaacgtcccccgcgtcggattgtgaggagttggactcagaccaattcaaggaatctgaaactttggaca
gagacacttcagaaatagtcattgactttttgcaaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggtt
gtacagacaataaggagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctggg
tatggaagacagaggagatgacatgcatataattaggacagtggctaaggagctcttcagcgatggcatcaccaactggg
gtcgaatcgccagcctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagt
cttgtgggccaagagatttcctcatatcttctttcagaccaaaaagactggctactgaaaaataaagcatgggatggctt
tgtggagttttttcatgtcccggatcccgagtcaaaaatgaggaatgcattaatggccttggttactgcagcaggtgttg
gagcaggacttgttttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4E3I4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=801 residues).
atggaagctcacggtggagttcagatcaacatggcagctcatcctggaggcagtatctgtgctccggttctccatggaag
ttcttttggaggtccagtcacactgatatacctcatacacggaggtcagggaggttccagttccagctcagctcagacgg
gttctcctgctgctcctgaactcactcacgtccaggtcaacagcattagcattagcagcaccaaggagcaaaccaccatc
agcctgtgtgacggagaggtgaccgtgctgattaaaccgaaaccaaagggccgagtcaggctggaggaggagaccctctg
catcatcggggatttttaccagggatacaggagccgaaaccagcacccagcctcggacacgctgagcagagtggtggagg
ggatgctccacaaacacagtgttgcctacagcggtatggtccagcgattgtgtttggagcagcaagacgatagcatggaa
tttattagcagcgtggcgaagaccctgtttgatgatgggatcaccaactgggggcggattgccagtctggtggcgttggg
tgcggtggtctgtgagtggctgaaggaggtgggcagagagcagtgtgtggagaacgtcatacaacacatctcaatgtacc
tcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaagacgactcc
gagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactgatgcgctg
a
>gnl|bcl2dbcds|A0A3B4E3I4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=729 residues).
atggagagcgccgccatcagcctgttctgtaacggagcggggaggatcccgttcaacaagggctcggagagccagctgga
ccgcccggaccggcccgaccgcggcctggagggactacaggcagcgcccggacccgctagcaaggccgccatggccggag
ggtcgctgcccgagtccccggagtccgacgacttcgtgcccgacttcggcggcagcgccctggtggaggagacccggcgg
ctcatcgggggcttttaccgcggatatatcggccagaagacccgggaccagcaccccgcccacggcacgatgagcagggt
ggtggagggggtgatcctcaagcacagcatcgcgtacaacggtatggtccagcgattgtgtttggagcagcaagacgata
gcatggagtttattagcagtgtggcgaagaccctgttcaatgatgggaccaccaactgggggcggattgccagtctggtg
gcgtttggtgcggtggtctgtgagcagatgaaggaagcaggcagagagcagtgtgtggagaacgtcatacaacacatctc
aacgtacctcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaag
acgactccgagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactg
atgcgctga
>gnl|bcl2dbcds|A0A3B4E3I4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=801 residues).
atggaagctcacggtggagttcagatcaacatggcagctcatcctggaggcagtatctgtgctccggttctccatggaag
ttcttttggaggtccagtcacactgatatacctcatacacggaggtcagggaggttccagttccagctcagctcagacgg
gttctcctgctgctcctgaactcactcacgtccaggtcaacagcattagcattagcagcaccaaggagcaaaccaccatc
agcctgtgtgacggagaggtgaccgtgctgattaaaccgaaaccaaagggccgagtcaggctggaggaggagaccctctg
catcatcggggatttttaccagggatacaggagccgaaaccagcacccagcctcggacacgctgagcagagtggtggagg
ggatgctccacaaacacagtgttgcctacagcggtatggtccagcgattgtgtttggagcagcaagacgatagcatggag
tttattagcagtgtggcgaagaccctgttcaatgatgggaccaccaactgggggcggattgccagtctggtggcgtttgg
tgcggtggtctgtgagcagatgaaggaagcaggcagagagcagtgtgtggagaacgtcatacaacacatctcaacgtacc
tcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaagacgactcc
gagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactgatgcgctg
a
>gnl|bcl2dbcds|Q9Z1P3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rattus norvegicus GN=MCL-1 (length=993 residues).
atgtttggccttcggagaaacgcggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggcggcggctc
tccggccgggacgcgcctggcggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgctctgctgcccggcg
cgcgggtggtcgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcggcagagaggcggctgctcaag
tcgcccggcctcctcgccgtgccgcctgaggagatggccgcgtcggccgccgccatcatgtctcccgaggaggagctgga
cggctgtgagccggaggtgctcagcaaacgcccggcggtgctgcccctactggagcgcgtgagcgaggcggctaagagct
ccggagctgacggctcgctgccctccacgccgccgccgcctgaggaggaagacgacgagctgtaccaccagtcgctggag
atcatctcccgctacctgcgggagcaggcgacgggctccaaggacgcgaagcctctgggcgaggccggcgcagcgggccg
gagggcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgcttcgga
aactggacattaaaaacgaggacgatgttaaatctttttctcgagtgatgacccatgttttcaaagatggcgtaacaaac
tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttaaagagcataaaccaagaaagctgcat
cgaacctttagcagaaagtatcacagacgttcttgtaaggacgaagcgggactggcttgtgaaacaaagaggctgggatg
ggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctgga
gtaggggctggtctggcatatctaataaggtag
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=816 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6PPL1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=816 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6PPL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6PPL1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=813 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
tctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=594 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccctgcggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=1053 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q0KFR9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo salar GN=MCL-1 (length=858 residues).
atgagyctgtcgaactcgattacacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctaggccgttgtactatttccagggggctggggccatatgtgctggggcgtcaccgaagtctaaagtggacttgg
gaaatgggactggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacggccttgataatcat
ttgtctgaccgaagcaacaatgacgactctttgccgtgcactccccagatggcgtcagaatgtgggcctgaactatcgaa
ttgtccatcgggcgatgaagtattggaacatgataccagacaactcattgagaattttttgggggactacacaggactgt
ctcagcctcgatggacgcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatac
gcatacaatggtatggtcgccaaacttgacttggatgaccgatgcgatgacatgggcgtcatcaattctgtggccaagac
catgttcagtgacgggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctga
aggagaggggcaggggacactgcgttgagttggtgggccaagagattgccaaatacctcctctctgaccaaagtgactgg
ctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgtacaagatcctgagtcctcagtaaggaacaccct
cctagcctttgctggagttgctggaattggggcaacactcgccatgttcatcaggtga
>gnl|bcl2dbcds|G3WBC5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=789 residues).
gacgtcaccgccccgccgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagc
cgcggacgccatcctatcccccgaggacgagctggacggttacgagcccgagctccccgggaagcggcccgctcgcctgg
ccatgctgcccttggccagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggcc
gaggaggacgaggacgaggaggaggatgagttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggc
ggtcggcaccaaggacaccaagcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccaga
ggaaccacgagacggctttccaaggtatgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgc
gtggtaactcatgtgttcagtgacggggtgacgaattggggcagaattgtgactctcatttctttcggggcctttgtggc
aaagcacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcga
aaagggactggctgatgaagcagaagggctgggaggggtttgtggaattctttcatgtagaggacctagaaggtggcatc
agaaatgtgctgctcgcctttgccggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2U9CJ81_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=873 residues).
atgaatatcattccttccacaaagcgggccgccttcaacgttacgaccggagtcatgggctgcctcattcttcctcaaaa
tggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgccgtgggctccgtgatcgactccc
gcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccaggtctccgcaacgaaggcgtacgcggcc
aagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctccaccccggagtcggacggcga
gcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtggtggaccgactggtg
gagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaacagaagggacgatgtgacgtttgtcgg
cgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctccagcctggtggcgttcggggccgtgg
tgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggagatctccacatacctgctgacg
gaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
aatgaggaacacactgattggccttgctggatttgctggtgttggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3B4T8L9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Seriola dumerili GN=MCL-1 (length=948 residues).
atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaactattgcatttgtcgtcaaaatggaggattgga
aacttggaccgacggctccggagactcctcgccggagattgccattggctctacaatatgttctcacaacgggaatgttg
tgccaaatgataattctaaacggcccaagagcctggaagtcacctcaacaaatgggtatgcaacaaaagcgagtcgggag
gacagcgacgtcgacgacggctctttgccgtgtactccggagattcagtcggacggagaaaccgatgtccctagttgtcc
agcaggggatgaagtgttggaggacgatacgaggcaacttattagccagtccatgaaaagctttaccggacgctcgatac
cgcggtggactgaacacagagcactacaaacaatgaagagggttgtggacggcgttttggaaaaacacagatacgcatac
aatggtatgatcaacaaactgtcactggacaacacaggggatgatgtgaggtttgtcggtgcagtagcgaagagcctgtt
cgcagatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggcggtggtgtgtcagcgcatgaaggaga
caggcagggagaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctgatcagcgagactggctggtg
aaaaacaactcctgggatggctttgtagcgttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggc
ctttgctggatttgcgggaatcggcgcaacactggccctgttgatcaggtgtttgtttgagcggtccaggccaaagcagg
aagggaaaattgcattttttccaatgtcatgcagtcgtgaagcccatttccatagagctcattcataa
>gnl|bcl2dbcds|A0A3B4T8L9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Seriola dumerili GN=MCL-1 (length=861 residues).
atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaactattgcatttgtcgtcaaaatggaggattgga
aacttggaccgacggctccggagactcctcgccggagattgccattggctctacaatatgttctcacaacgggaatgttg
tgccaaatgataattctaaacggcccaagagcctggaagtcacctcaacaaatgggtatgcaacaaaagcgagtcgggag
gacagcgacgtcgacgacggctctttgccgtgtactccggagattcagtcggacggagaaaccgatgtccctagttgtcc
agcaggggatgaagtgttggaggacgatacgaggcaacttattagccagtccatgaaaagctttaccggacgctcgatac
cgcggtggactgaacacagagcactacaaacaatgaagagggttgtggacggcgttttggaaaaacacagatacgcatac
aatggtatgatcaacaaactgtcactggacaacacaggggatgatgtgaggtttgtcggtgcagtagcgaagagcctgtt
cgcagatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggcggtggtgtgtcagcgcatgaaggaga
caggcagggagaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctgatcagcgagactggctggtg
aaaaacaactcctgggatggctttgtagcgttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggc
ctttgctggatttgcgggaatcggcgcaacactggccctgttgatcagcgccatgatgtga
>gnl|bcl2dbcds|A0A3B4XKA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=MCL-1 (length=858 residues).
atgaatcttatccaggcaccgaaacaggccgctttaaccgccgtgaactattgcatttgtcgtcaaaatggaggattgga
gacttggagggacagctccggagactcctcgccggagattgccattggctctacattatgttgtgacaacgggaatgttg
tgccaaatgataattctaaacggcccaagagcctggaagtcacctcaacaaatgggtatgcaacaaaagcgagtcgggag
gacagcgacgtcgacgacggctctttgccgtgtactccggagatgcagtcggatggcgaaaccgacgtccctagttgtcc
agctggggaagtgttggagtccgatacgagtcaactcattagccagtccatgaaaagctttaccggacggtcgatacagc
ggcggactgaacacagagcactacaaacaatgaagagggttgtggaaggcgttttggaaaaacacagatacgcatacaat
ggtatgatcaacaaactgtcactggacaacagaggggatgatgtgaggtttgtcggtgcagtagcgaagagcctgttcgc
agatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggtggtggtgtgtcagcacatgaaggacacag
gcagggagaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctgatcagcgagactggctggtgaaa
aacaactcctgggatggatttgtatcgttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggcctt
tgctggatttgcgggaatcggcgcaacactggccctgttgatcagcgccatgatgtga
>gnl|bcl2dbcds|A0A3B4ZKP6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Stegastes partitus GN=MCL-1 (length=855 residues).
atgaacattattccgacgacgaaacggacggcgctcatgagctgctttattcttcctcaaaatggagtcgttgagggaca
gatgcactacggatcaggagatccctccgcacagatccccatggcctcccctttggactcacacaacgggaatgtcggct
ccggcgccaccccgaagaggcccaagaacctgggagtgtccacgacgaacgggtttgcgggaaagggcctccgacaggtc
agcgacagcctggaggacagctcgctaccgtgcactccggagctacagtcggacagtgaaaccgacgtgtcgagttgccc
ggcgggggacgaggtgctggagaatgacacgaggcaactgattagcagcttcctaaaagactttactggactttcaaagc
ctcggtggaacgagggcaaagcattatctacaatgaaaagagttgtggaggacgttttggaaaagcacagatacgcgtac
aacggtatgatcaacaaactgtcgctggatgacagaggggacgatgtgtcgtttgtcagtgccgtagccaagagcctctt
cgcagacaggaccaccaactggggtcgcatcaccagcctggtggccttcggggcagtggtgtgccagtacctgaaggaga
ggggcagggagaactgcgtcgacctggtgagcgaggagatttccacatacctgctctgcgatcagcgagactggctggtg
aagaacaactcatgggatggctttgtagagtttttccgagtggcagaccctgaactgacggtcaggaacacactcatggc
ctttgctggatttgccggtattggggcgacactggccctgctgatcaggtcatga
>gnl|bcl2dbcds|K9IWB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|K9IWB2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|K9IWB2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1008 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatatctaataagatagccttttaa
>gnl|bcl2dbcds|Q95KR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=459 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
acgttttaagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
aagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactg
gctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A3B5K5B3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Takifugu rubripes GN=MCL-1 (length=819 residues).
atgaatattattgcgaatcacaccgcgttgagaatcatgaatgtggtgttccaaaatggagtcgtggacggagcggggca
ttcctccccgctgatcccgatggcttccagaggctccctcagcggcaacgacagcccgaagcggcccagcaagctctccg
tgatcgcacccaaggtttgcgtggcgaaggccatccaggaggacagccaggacaccgaccaccggtcggcgccgtgtacg
ccggagatgaactcggtgaacgggttggacgtgtccgggcgcccagcggaggacgaggcggcgttagacaacgacacgag
gcagctcctcagctgcttcatggcggacttttgcggcatcggttcacatcagtggagggagagcggagcgctgtcgacca
tgaagcgagtggtggcgaacctgatggaaaagcaccgatacgtgtacaatgggatgaccaaacagttgaccctggacgac
agaggagacgatgtgagcttcgtcagctcggtagccaaaagcatattcgcagacggggtcaccaactgggggcgcatcgc
cagcctagtggcctttggagccgtggtggcccagcacatgaaggacaatggtcggagggactgcgtggagccggtggcgc
aggagatctccacgtacctgttgacggaccggcgggactggctgatcaaaaacaacggctgggaaggatttgtggagttt
ttccaagtatcggacccagagtcgtcagtcaggaacatgctgatggccgtcgcgggggttgccgggctcggggccacgct
ggccctgttgatccggtga
>gnl|bcl2dbcds|Q4SW32_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Tetraodon nigroviridis GN=MCL-1 (length=816 residues).
atgagcgttatcgcgaaccgcaccgcgatagacaccatgaatgttatgtttcaaaatggagtcggggacgcggatctttc
ttcctcgcagatcccgatgggctctcccagggacgctttcaacgggaacgtcggcgacagcccgaagcggcccagcaagc
tgacggtggtcaaacccaaggtctgcctgtcgaagaccattcaggaggacagcgaggacggctcgctgccgtgtacgccg
gagtcgcactcgggcgacgtgctggacgtgtccgggcgtccggcgggggacgaggcggctctcgacagcgacacgaggca
gctggtgagccgtttaatggcggacgttaccggcatcagcagagcccagtggagggagagcagagcgctggcgacgacga
agcgagtggtgggagacctgatggagaagcaccgatacacgtacagaggtatgatcaacaaattgttcatggaggaccga
gtaggcgacgtgagctttgtcggcgccgtggctaagagcacgttcgaggacgggaacaccaactggggtcgcgtggccag
cctgctggccttcgcagccgtggtggcccagtacttgaacgaccacggtcagagggactgcgtggagcaggtggcccagg
aaatctccacctacctgttgacggaccagcgcgactggctgatcaaaaacaacgcctgggacggatttgtggagtttttc
caagtgccggacccggagtcgacggtccggaccgtgctgatggccgtggcaggagtggctgggatcggcgccaagctggc
gctgctgatcaggtga
>gnl|bcl2dbcds|A0A2U3V2H3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Tursiops truncatus GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtagggggaggggaag
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccgcgccaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggtctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggccagtaacagcccgggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgccagccggaaagcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A452RHX5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ursus americanus GN=MCL-1 (length=1053 residues).
atgtttggcctgaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgctagtcccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctt
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|B6V6J0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xenopus laevis GN=MCL-1 (length=828 residues).
atgatgcaccagtcagtaattgccaagcagcgcccctcgactagtttcctcattccctgccagttttactgctcgggcgg
cggctcctcagagaagacattgagcgcgcgtggggcttctccgtgggaccccgatatggacacgcacaggccgcagctga
atggcttgggctttaacaacggggggtcgctgccttgttcccaggaggatgaattagatgaggatatggataacggatcc
cagggttccacgtctcccccggacagccccgtgtgccctaaggatggattatatatggacacccagcagctcattctcgc
tttctaccgcgtgtacagcggcgaggagagcggcgaattagaggcttcctgtctcctccaacatggcgtccaccacaaag
ccctggaaaccctgctgagggtcgggggagagattatagagaagcaccacatggccttcacgggcatgctacaaaggttg
tctatacatagcagagaagacttgcagaaactttctgaggttcccgctttggtctttaatgacggagttacaaattgggg
ccgcattgttacggtcataagctttggcgcgtttgttgcaaagcatctaaagagcttaaaccttgaagactgcatcggag
ttttggcagagcacttcacgcagttcctaatgatgagcaaaaaagactggataatacaggaaaagggatgggatggcttt
gtggacttttttcacatagaagattatgaaagtggactgaaaactgttttgatggctttctcaagtgttgctgttcttgg
ggccggtttggcgtacatgatccgatga
>gnl|bcl2dbcds|F7ETY1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xenopus tropicalis GN=MCL-1 (length=852 residues).
atgatgcgccagtcggtcattgccaagcagcgtacctctgcgggcttcctcatcccctgccagttctactgctcgggtgg
cggcggcgggaacgcctcagagaaggcagtgaatgaccgaggggcttctccgtgggacgccgatatggaggcgcataggg
ataagctggacaggccgcagctgaatggcttcgggtttaacagtggggggagccttactgcctcccaggagggagaattg
gatgaggatattgatggcggctcccagggttctagctcccccccggacagccctgtgtgcccgaaggatggattatatat
ggacacccagcagctcatcctggctttcttccggggatactgcggggaggaaaccagcggcttaaaggcctccttcctcc
tccatcatggcgcccaccccaaggccctggagaccctgcagcgggtcgggggagacattatagagaagcaccatatggcc
tttactggcatgctgcaaaggttgtctatacatagtagagaggacttgcagaaactttccgaagttcccgctttggtctt
taatgatggagttacaaactggggccggattgttaccgtcataagctttggtgcgtttgttgcaaagcatctaaagagca
tagaccttgaagactgtatcatggctttggcggagcacttcacactattcctaatgacaagcaaaaaagactggataatc
caggaaaagggatgggagggctttgtggacttttttcacatagaagactatgaaagtggactcagaactgttttgatggc
tttctcaagtgttgcggttcttggggctggcttggcgttcatgatccggtga
>gnl|bcl2dbcds|A0A3B5PQ55_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=MCL-1 (length=828 residues).
atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaatggagtcgggaatggacaaacacactacga
ccagggactcggtgtgcctgaggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatcccttcatgaaac
gcccgacgaatctcggagtgaatggatatgttgcgaaaagccttccgacgagcagcgacgacagcgacgaaggctctctg
ccatgcaccccggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagcaaccaagtgctggataacga
cacaacggagcttattagcagttttctgagagactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat
ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgcatacaatggtatggtcaataggcttgctctg
gataacgagccggacgacatggagtttgttacggaaatagcagagagtctcttttcagacgggatcaccaactggggtcg
gatcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggagaggggcagagagcactgcgtggagctgg
tgagccggaaaatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtg
gagttctttagagtatcggacccggagtctacagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc
caccttagcctttcttatcagcttctga
>gnl|bcl2dbcds|A0A3B5PQ55_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=MCL-1 (length=843 residues).
atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaatggagtcgggaatggacaaacacactacga
ccagggactcggtgtgcctgaggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatcccttcatgaaac
gcccgacgaatctcggagtgaatggatatgttgcgaaaagccttccgacgagcagcgacgacagcgacgaaggctctctg
ccatgcaccccggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagcaaccaagtgctggataacga
cacaacggagcttattagcagttttctgagagactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat
ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgcatacaatggtatggtcaataggcttgctctg
gataacgagccggacgacatggagtttgttacggaaatagcagagagtctcttttcagacgggatcaccaactggggtcg
gatcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggagaggggcagagagcactgcgtggagctgg
tgagccggaaaatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtg
gagttctttagagtatcggacccggagtctacagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc
caccttagcctttcttatcaggagatgcaaagagaagtattga
© 1998-2019